In the early 20th century, goiter was relatively common in the Midwest. Why was this so? How

Question:

In the early 20th century, goiter was relatively common in the Midwest. Why was this so? How has it been eliminated?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Biochemistry

ISBN: 9781305961135

9th Edition

Authors: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

See More Books

Question Posted: Dec 16, 2023 06:35 AM

See More Questions

Is marketing practice little more than 'telling and selling', while marketing science is really just a matter of carrying out experiments, tests, surveys and other research to help organisations sell...
Managing Scope Changes Case Study Scope changes on a project can occur regardless of how well the project is planned or executed. Scope changes can be the result of something that was omitted during...
The Gode family arrived from the UK in 1862 to the Manly, Tingalpa and Wynnum area in Brisbane. They started developing farming and property businesses and some of the family went into law. Another...
Differentiate implicitly to find 2x + 5xy + 5y +16y - 8 = 0; dy dx . Then find the slope of the curve at the given point. (-2,0)
As sales manager, Magic Johnson was given the following static budget report for selling expenses in the Clothing Department of Lakers Company for the month of October. As a result of this budget...
In June 2006, a Korean investor is considering investing in bank deposits in Korea and Japan. The annual interest rate on Korean deposits is 6.25%, versus 3.75% on deposits in Japan. Suppose that the...
During the period ended 30 June 2023, Ru Li, an employee of Westshore Company, purchased goods from the company on normal commercial terms and conditions. Li receives remuneration consisting of cash...
Pamela Quinn started her own consulting firm, Quinn Consulting, on May 1, 2012. The trial balance at May 31 is as shown below. In addition to those accounts listed on the trial balance, the chart of...
1. 20 The full symbols of atoms of elements R, T, X, Y and Z are 2R, 31, 30, 34X, and 5Z respectively 15 15 164, Which one of the following is an isotope of Y A. R B. T C. X D. Z 2. The electronic...
Immature rats are fed all the essential amino acids but one. Six hours later they are fed the missing amino acid. The rats fail to grow. Explain this observation.
It has been suggested that limits be put on the dose in vitamin A supplements sold in stores. What is a possible reason for this limitation?
If a bond's coupon rate is above the investor's required rate of return on the bond, would the bond's price be above or below its par value? Explain.
All 4 parts to this question please. Thank you. It is all part of one question, use the information from the top. THANK YOU 1) Suppose Fuzzy Button Clothing Company's assets are fully utilized. Use...
Loss Carryforward The Bookbinder Company had $380,000 cumulative operating losses prior to the beginning of last year. It had $80,000 in pre-tax earnings last year before using the past operating...
Martinez Company's relevant range of production is 7,500 units to 12,500 units. When it produces and sells 10,000 units, its average costs per unit are as follows: Average Cost Per Unit Direct...
Marwick's Pianos, Incorporated, purchases pianos from a manufacturer for an average cost of $1,505 per unit and then sells them to retail customers for an average price of $2,600 each. The company's...
Problem Statement: Social Media Dashboard using Django Overview: You are tasked with creating a Social Media Dashboard using Django, allowing users to view and manage their social media activity from...
The manager of Image Maker, Inc., prepared the companys balance sheet as of March 31, 2012, while the accountant was ill. The balance sheet contains numerous errors. In particular, the manager knew...
H Corporation has a bond outstanding. It has a coupon rate of 8 percent and a $1000 par value. The bond has 6 years left to maturity but could be called after three years for $1000 plus a call...
Chaperones are generally thought to facilitate protein folding. What additional functions do mitochondrial chaperones perform?
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?
1. (10 pts) List all the functional dependencies that below relation instance satisfies. X Y 2 X1 Y1 Z1 x1 Y1 22 X2 Y1 21 X2 Y1 23 2. (10 pts) Give a set of FDs for the relation schema R(A,B,C,D)...
what ways can advancements in data analytics and predictive modeling enhance our understanding of the complex dynamics underlying social mobility, and how can this knowledge be leveraged to inform...
At the beginning of January, in an attempt to make more money and avoid going bankrupt, Peloton struck a partnership deal with Lululemon that for every Peloton bike purchased, the customer would...

In the early 20th century, goiter was relatively common in the Midwest. Why was this so? How

Question:

Step by Step Answer:

Low levels of iodine in the diet often ...View the full answer

Biochemistry

Students also viewed these Sciences questions