Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. Exons b. Caps
Question:
Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________.
a. Exons
b. Caps
c. Poly-A tails
d. Introns
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 58% (12 reviews)
In the process of RNA processing the introns are removed in th...View the full answer
Answered By
Marvine Ekina
Marvine Ekina
Dedicated and experienced Academic Tutor with a proven track record for helping students to improve their academic performance. Adept at evaluating students and creating learning plans based on their strengths and weaknesses. Bringing forth a devotion to education and helping others to achieve their academic and life goals.
PERSONAL INFORMATION
Address: , ,
Nationality:
Driving License:
Hobbies: reading
SKILLS
????? Problem Solving Skills
????? Predictive Modeling
????? Customer Service Skills
????? Creative Problem Solving Skills
????? Strong Analytical Skills
????? Project Management Skills
????? Multitasking Skills
????? Leadership Skills
????? Curriculum Development
????? Excellent Communication Skills
????? SAT Prep
????? Knowledge of Educational Philosophies
????? Informal and Formal Assessments
0.00
0 Reviews
10+ Question Solved
Related Book For
Concepts Of Biology
ISBN: 9781938168116
1st Edition
Authors: Samantha Fowler, Rebecca Roush, James Wise
Question Posted:
Students also viewed these Life Sciences questions
-
A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) position,...
-
During RNA processing A.) All of the exons are removed and discarded B.) The RNA molecule is made from a DNA template C.) Introns are cut from the RNA and the exons are spliced together D.) The RNA...
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
According to Dr. Grant, creatives are people who ________. A. Are procrastinators B. Act on multiple ideas C. Plan out each detail D. Are highly confident with no doubts about their success
-
The treasurer of Westmark Industrial, Inc., a wholesale distributor of household appliances, wants to estimate his companys cash balances for the first three months of 2015. Using the information...
-
How much energy is released when tritium, 3/1H, decays by emission?
-
Washington Mutual Insurance Company issued an \(\$ 80,000,7 \%, 10\)-vear bond payable at a price of 110 on January 1, 2009. Journalize the following transactions for Washington. Include an...
-
Bennis Corporation was organized on January 1, 2014. It is authorized to issue 10,000 shares of 8%, $100 par value preferred stock and 500,000 shares of no-par common stock with a stated value of $1...
-
Assignment: PART 5 (30 points): Mr. Smith died, leaving an insurance policy to his heir, John Smith. The contract provides that the beneficiary can choose any one of the following four options: A)...
-
Scenario: You are an accountant at Rock Castle Construction. Your boss has asked that you create general purpose financial statements from a trial balance that he has created for you. Additionally,...
-
The RNA components of ribosomes are synthesized in the ________. a. Cytoplasm b. Nucleus c. Nucleolus d. Endoplasmic reticulum
-
A promoter is ________. a. A specific sequence of DNA nucleotides b. A specific sequence of RNA nucleotides c. A protein that binds to DNA d. An enzyme that synthesizes RNA
-
Murphy Delivery Service completed the following transactions during December 2025: Requirements 1. Record each transaction in the journal using the following chart of accounts. Explanations are not...
-
A horizontal pipe of diameter 0.903 m has a smooth constriction to a section of diameter 0.5418 m. The density of oil flowing in the pipe is 821 kg/m. If the pressure in the pipe is 8450 N/m and in...
-
1. Analyze the reasons China has a twin surplus. 2. What are the repercussions of this fact over a long period of time? 3.I just need help wtih the consequences.
-
If a = 8.8 mm, b = 7.7 mm, Q = 19 nC, Q = 57 nC, and q = 29 nC in the figure, what is the magnitude of the electric force on q? Round your answer to 1 decimal place. Add your answer a 90- b 600 9 I
-
Calculate the geometric mean return of an investment with five year returns of 10%, (15%), 12%, 8% and (5%).
-
Calculate the final selling price to the nearest cent and markdown percent to the nearest hundredth percent: Original selling price $4,900 First markdown 20% Second markdown 10% Markup 12% Final...
-
Briefly explain the path-goal theory.
-
Design a circuit which negative the content of any register and store it in the same register.
-
Certain proton pump inhibitors inhibit secretion of stomach acid and are among the most widely sold drugs in the world today. What pump does this type of drug inhibit, and where is this pump located?
-
The membrane potential in animal cells, but not in plants, depends largely on resting K + channels. How do these channels contribute to the resting potential? Why are these channels considered to be...
-
Patch clamping can be used to measure the conductance properties of individual ion channels. Describe how patch clamping can be used to determine whether or not the gene coding for a putative K +...
-
Dollar-Value LIFO On January 1, 2018, Sato Company adopted the dollar-value LIFO method of inventory costing. Sato's ending inventory records appear as follows: Year Current Cost Index 2018 $31,600...
-
How many standards are included in the ELP accreditation standards? What stands out to you about the different areas? What are the topic areas under administration and leadership? What are the...
-
What is performance management systems? Do the companies where you (or others you know) have worked used performance management systems rather than performance appraisal systems? If yes, what kind of...
Study smarter with the SolutionInn App