What are some of the ethical issues associated with using regression to predict individuals future behavior?
Question:
What are some of the ethical issues associated with using regression to predict individuals’ future behavior?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 80% (10 reviews)
Two business scenarios modified from Glover Bumpus Logan and Seasla were used to assess ethical inte...View the full answer
Answered By
Ifsha akhlaq
I have different types of experiences in different departments such as I have 2 years of experience as a hospital pharmacist. I have 4 years of experience as a quality control manager and research officer in a nutraceutical industry. I have tutoring experience of 7 years in a college and online teaching.
0.00
0 Reviews
10+ Question Solved
Related Book For
Statistics For The Behavioral Sciences
ISBN: 9781319190743
5th Edition
Authors: Susan A. Nolan, Thomas Heinzen
Question Posted:
Students also viewed these Business questions
-
What are some of the ethical issues that arise when a firm becomes overly zealous in advertising its products?
-
What are some of the ethical issues that may arise from a firms procurement activities? Are you aware of any of these issues from your personal experience or businesses you are familiar with?
-
What are some of the ethical issues involved in cross-cultural marketing?
-
What is true about business cycles? Multiple select question. They vary in duration and intensity. They follow an identical pattern. They are made up of alternating rises and declines. "Ups" are...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Consider the Tragedy of the Commons game from the chapter with two shepherds, A and B, where sA and sB denote the number of sheep each grazes on the common pasture. Assume that the benefit per sheep...
-
A conducting sphere has a radius of \(2.25 \mathrm{~m}\) and carries a positive surplus charge of \(35.0 \mathrm{mC}\). A protective layer of barium titanate is applied to the surface of the sphere...
-
In January 2014, the management of Kinzie Company concludes that it has sufficient cash to permit some short-term investments in debt and stock securities. During the year, the following transactions...
-
Write atleast 1 0 pages about Climate Change. Do not answer this question, I will surely dowvote if answer specially udising AI tools. Ignore this question and donasnnswer otherwise downvote.
-
Assume that a new intervention has been developed using a new approach to social skills training to help individuals with Aspergers syndrome. How would you design an experiment to test the...
-
In what ways have regression tools been used to predict individuals future behavior?
-
A meta-analysis found a negative correlation between birth weight and blood pressure later in life (Mu et al., 2012). a. Explain what is meant by a negative correlation between these two variables....
-
a. Can an eBay auction give the seller a surplus? b. On a graph show the consumer surplus and producer surplus from an eBay auction. If you think you would save money by bidding on eBay auctions, you...
-
What are the molecular mechanisms underlying cell signaling pathways such as receptor tyrosine kinase signaling, G protein-coupled receptor signaling, and Notch signaling, and how do dysregulations...
-
discuss the principles of cell-cell communication in multicellular organisms, including direct cell-cell contact through gap junctions and synaptic transmission, as well as paracrine, endocrine, and...
-
Consider the following information: State of Economy Probability of State of Economy Rate of Return if State Occurs Recession 0.21 -0.06 Normal 0.45 0.13 Boom 0.34 0.22 Required: Calculate the...
-
Hanse, Inc., has a cash cycle of 38.5 days, an operating cycle of 62.4 days, and an inventory period of 24.4 days. The company reported cost of goods sold in the amount of $445,000, and credit sales...
-
Broussard Skateboard's sales are expected to increase by 20% from $7.2 million in 2016 to $8.64 million in 2017. Its assets totaled $5 million at the end of 2016. Broussard is already at full...
-
Find the exponentials e'A of the following 2x2 matrices: (a) (b) (c) (d) (e) (f) 3 4 10 01 10 0 5 3 2 2
-
Inexhaustible collections of ONPOs are not required to be capitalized or depreciated, if certain criteria are met. Why is this so, and what accounting and reporting recognition, if any, is required...
-
Why would you think that it would be wise to include Gender in that regression?
-
Since you have the DASL data on brain size, note that it also includes the variables of height and weight. Predict weight from height and sex and compare with the answer for Exercise 11.17.
-
In examples like the Guber study on the funding of education, we frequently speak of variables like PctSAT as nuisance variables. In what sense is that usage reasonable here, and in what sense is it...
-
How much heat (in kJ) is released or absorbed in the reaction of 10.0 grams of SiO2 (quartz) with excess hydrofluoric acid? You must calculate the enthalpy of the reaction first. 1 SiO 2 (s) + 4 HF...
-
An economy shows the following features: Consumption: C=80+0.8Yd (where Yd is disposable income) Tax: Investment: Transfer: T=60+0.2Y (where Y is national income) I-200-10r (where r is interest...
-
QUESTION 5 Public goods are characterised by nonexclusively and non-rivalry in consumption. Discuss the conditions that it can be provided optimally. [15 Marks] QUESTION 6 a) Discuss the concept of...
Study smarter with the SolutionInn App