(a) How is messenger RNA related to polysome formation? (b) How does rRNA differ from mRNA and...
Question:
(a) How is messenger RNA related to polysome formation?
(b) How does rRNA differ from mRNA and tRNA in specificity?
(c) How does the tRNA molecule differ from that of DNA and mRNA in size and helical arrangement?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 91% (12 reviews)
a Polysomes are formed when two or more ribosomes are simultaneously translating ...View the full answer
Answered By
Ashington Waweru
I am a lecturer, research writer and also a qualified financial analyst and accountant. I am qualified and articulate in many disciplines including English, Accounting, Finance, Quantitative spreadsheet analysis, Economics, and Statistics. I am an expert with sixteen years of experience in online industry-related work. I have a master's in business administration and a bachelor’s degree in education, accounting, and economics options.
I am a writer and proofreading expert with sixteen years of experience in online writing, proofreading, and text editing. I have vast knowledge and experience in writing techniques and styles such as APA, ASA, MLA, Chicago, Turabian, IEEE, and many others.
I am also an online blogger and research writer with sixteen years of writing and proofreading articles and reports. I have written many scripts and articles for blogs, and I also specialize in search engine
I have sixteen years of experience in Excel data entry, Excel data analysis, R-studio quantitative analysis, SPSS quantitative analysis, research writing, and proofreading articles and reports. I will deliver the highest quality online and offline Excel, R, SPSS, and other spreadsheet solutions within your operational deadlines. I have also compiled many original Excel quantitative and text spreadsheets which solve client’s problems in my research writing career.
I have extensive enterprise resource planning accounting, financial modeling, financial reporting, and company analysis: customer relationship management, enterprise resource planning, financial accounting projects, and corporate finance.
I am articulate in psychology, engineering, nursing, counseling, project management, accounting, finance, quantitative spreadsheet analysis, statistical and economic analysis, among many other industry fields and academic disciplines. I work to solve problems and provide accurate and credible solutions and research reports in all industries in the global economy.
I have taught and conducted masters and Ph.D. thesis research for specialists in Quantitative finance, Financial Accounting, Actuarial science, Macroeconomics, Microeconomics, Risk Management, Managerial Economics, Engineering Economics, Financial economics, Taxation and many other disciplines including water engineering, psychology, e-commerce, mechanical engineering, leadership and many others.
I have developed many courses on online websites like Teachable and Thinkific. I also developed an accounting reporting automation software project for Utafiti sacco located at ILRI Uthiru Kenya when I was working there in year 2001.
I am a mature, self-motivated worker who delivers high-quality, on-time reports which solve client’s problems accurately.
I have written many academic and professional industry research papers and tutored many clients from college to university undergraduate, master's and Ph.D. students, and corporate professionals. I anticipate your hiring me.
I know I will deliver the highest quality work you will find anywhere to award me your project work. Please note that I am looking for a long-term work relationship with you. I look forward to you delivering the best service to you.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Principles of Genetics
ISBN: 978-1119142287
7th edition
Authors: D. Peter Snustad, Michael J. Simmons
Question Posted:
Students also viewed these Life Sciences questions
-
Outline how the genetic message in a gene is translated to produce a polypeptide. Include the roles of the gene, messenger RNA, ribosomes, and transfer RNA.
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
-
Compute the indicated quantities for the given homomorphism. Ker () for : S 3 Z 2 in Example 13.3 Data from Example 13.3 Let S n be the symmetric group on n letters, and let : S n Z 2 be defined by...
-
Why should you sometimes use normal-curve areas to approximate binomial probabilities even though you have a formula for computing them exactly?
-
What type of professional services was PwC providing to the TFG? What professional standards apply to such engagements?
-
Consider the use of social media in selling
-
Correct Intangible Asset Account As the recently appointed auditor for Hillary Corporation, you have been asked to examine selected accounts before the 6-month financial statements of June 30, 2010,...
-
Jacy keeps track of the amount of average monthly rainfall in her hometown. She determines that the average monthly rainfall can be modeled by the function A(t) = 2.3 sin(+9.25 where A(t) represents...
-
A mixture of chloroform (CHC13) and acetic acid at 18oC and 1 atm (101.3 kPa) is to be extracted with water to recover the acid.(a) Forty-five kilograms of a mixture containing 35 wt% CHC13 and 65...
-
Identify three different types of RNA that are involved in translation and list the characteristics and functions of each.
-
Outline the process of aminoacyl-tRNA formation.
-
Which of the following statements assigns the first four characters in the strItem variable to the strWarehouse variable? a. strWarehouse = strItem.Assign(0, 4) b. strWarehouse = strItem.Assign(1, 4)...
-
Fomaco Inc. is expecting sales for the months of June to September as follows: June July Aug Sept 200,000 150,000 100,000 300,000 ($) -30% of sales are made on cash basis and the remaining 70% are...
-
Use the following information to answer the two questions below. State of Prob. of the the economy. Boom Bust state of economy. 0.75 0.25 Rate of return if state occurs Stock B Stock A 0.15 0.05 0.02...
-
You are the Audit Trainee at KIC Chartered Accountants and Auditors. You are part of the engagement team currently auditing Ezulwini Plumbing Manufacturers Ltd. This assignment is nearing the end....
-
Case Study: Auditing in Nonprofit Organizations Introduction: Auditing in nonprofit organizations presents a unique set of challenges and opportunities. In this case study, we examine the experiences...
-
Can you explain how to I can calculate the feasible region?. 1. An optimization programming model is formulated as follows: Max. Z = x + 2y s. t. 3x +123 x + 3y =2 -x + 2y = 2 5x +y's 15 2x -y24 x, y
-
In problem, find the real solutions of each equation. x 2 - 8x - 9 = 0
-
QUESTION 9 HC-O-C-R R-C-O-CH HC-O-P-O-CH-CH-NH3* O || O a. Phosphatidic acid, Serine O b. Lysophosphatidic acid, Serine, Free FA O c. Lysophosphatidylserine, Free FA O d. 2 Free FAs, Serine, Glycerol...
-
Suppose that the circulating concentration of hormone is 10 10 M and the Kd for binding to its receptor is 10 8 M. What fraction of the receptors will have hormone bound? If a meaningful...
-
Cells communicate in ways that resemble human communication. Decide which of the following forms of human communication are analogous to autocrine, paracrine, endocrine, and synaptic signaling by...
-
Why do signaling responses that involve changes in proteins already present in the cell occur in milliseconds to seconds, whereas responses that require changes in gene expression require minutes to...
-
The Pew Internet and American Life Project reported on the widespread use of the Internet to search for information regarding experimental treatments or medicines. From telephone interviews of 1005...
-
write the differences between Microprocessors and Microcomputers. compare between them and draw the block diagram for each one. B) define the interface and mention it's types with brief description....
-
Write a program that prompts the user for the constitutive parameters (relative permittivity, relative permeability, and conductivity) in medium 1 and medium 2 separated by a planar surface. You are...
Study smarter with the SolutionInn App