Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA...

  

Transcribed Image Text:

Initial DNA sequence 3 GCCATTACTGAGGATCGGAАТТСAGCTCTТАСАТTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it into its corresponding protein fragment. Don't forget to look for start and stop codons! Protein fragment= 2. Referring to the original DNA strand below, change the 11th base from adenine to cytosine to mimic a mismatch mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAATTCAGCTCTTACATTGCA5' mRNA= protein fragment= What happened? 3. Referring to the original DNA strand below, insert thymine between the 10th and 11th base to mimic an insertion mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAАТТСАGCTCTТАСАТTGCA5' mRNA= protein fragmentD What happened? Initial DNA sequence 3 GCCATTACTGAGGATCGGAАТТСAGCTCTТАСАТTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it into its corresponding protein fragment. Don't forget to look for start and stop codons! Protein fragment= 2. Referring to the original DNA strand below, change the 11th base from adenine to cytosine to mimic a mismatch mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAATTCAGCTCTTACATTGCA5' mRNA= protein fragment= What happened? 3. Referring to the original DNA strand below, insert thymine between the 10th and 11th base to mimic an insertion mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAАТТСАGCTCTТАСАТTGCA5' mRNA= protein fragmentD What happened?

Answer rating: 100% (QA)

1 Initial DNA sequence 3 GCCATTACTGAGGATCGGAATTCAGCTCTTACATTGCA 5 MRNA sequence 5 CGGUAAUG ACU CCU A... View the full answer