Name and describe the five major promotion tools used in a companys marketing communications mix.

Fantastic news! We've Found the answer you've been seeking!

Question:

Name and describe the five major promotion tools used in a company’s marketing communications mix.

Related Book For answer-question

Global Business

ISBN: 978-1133485933

3rd edition

Authors: Mike W. Peng

See More Books

Posted Date: Jan 12, 2021 05:19 AM

See More Questions

Name and describe the five factors that make an industry particularly conducive to collusion.
Name and describe the five strategies that are useful for improving creativity.
List and briefly describe the five major promotion mix tools.
Why is it helpful to understand leadership as a theory while managing a healthcare-orientated organization? Justify your stance using two examples. What factors do you think should appear in a model...
Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
The G. Saussy Manufacturing company is putting out four new electronic components. Each of Saussy's four plants has the capacity to add one more product to its current line of electronic parts. The...
5 percent interest per month. The sterilizer was delivered on August 23, 1996. The last payment was received on April 21, 1998. At the time of the last payment, the defendant still owed the plaintiff...
Alabama Airlines opened its doors in June 1995 as a commuter service with its headquarters and only hub located in Birmingham. A product of airline deregulation, Alabama Air joined the growing number...
6. (a) Given == 2-23i.Find |=| and arg (=*). Hence, solve z=2-23i leave your answers in polar form. (b) Given that z = 1 + i is a root of the polynomial equation z4-4z3 +11z2 - 14z + 10 = 0. Find the...
The paralegal is assigned the task of preparing an office legal memorandum. The memorandum is due in 10 days, and there is a 5-page limit. The facts and law are as follows: Facts: Mary was Tom's...
A car left Town A at 10:00 a.m. and travelled towards Town B at the average speed of 70 km/h. At the same time a truck left Town B and travelled towards Town A over the same road at an average speed...
Describe the effects of a decrease in the interest rate on present and next periods consumption if the individual is a net lender (i.e., has savings) after period 1 and the substitution effect is...
Why does real wage rigidity contribute to unemployment? What are its causes?
What is the natural rate of unemployment? What has caused the natural rate to change over time?
What benefits does a credible nominal anchor provide?
Suppose you are about to buy a car and ask to see a vehicle history report to check on previous accidents or problems reported for that car. When you are told that this information is not available,...
In your teams discuss and calculate the household income required to live in Canada as of now with base mortgage lending rate @6% per annum. Draw step by step calculations, groceries, utilities and...
Marc Company assembles products from a group of interconnecting parts. The company produces some of the parts and buys some from outside vendors. The vendor for Part X has just increased its price by...
After watching the video on Yum! Brands in China, discuss the following: 1. What strategic goals did Yum! Brands/KFC have when entering China? 2. What approach to and mode of entry do you believe...
Look at the countries on PengAtlas Map 4.3. Suppose your multinational team consists of people from these countries. In your opinion, is it possible to have too much diversity?
Microfinance is an emerging area of individualized financial investment in developing countries that is based on social responsibility principles. However, since it involves the investment of...
A Consider \[\begin{cases}\dot{x}_{1}=-x_{1}\left|x_{1} ight|+a x_{2}-\frac{2}{3}+\sin t & x_{1}(0)=\frac{2}{3} \\ \dot{x}_{2}=-x_{1}-\frac{1}{2} x_{2}-1, & x_{2}(0)=1\end{cases}\] where \(a\) is a...
The governing equation for an RLC circuit driven by the applied voltage \(v_{a}(t)\) is derived as \[L \frac{d i}{d t}+R i+\frac{1}{C} \int i d t=v_{a}(t)\] where \(L=4 \mathrm{H}, R=4 \Omega\), and...
The pendulum system in Figure 8.35 consists of a uniform thin rod of length \(l\) and a concentrated mass \(m\) at its tip. The friction at the pivot causes the system to be damped. When the angular...

Name and describe the five major promotion tools used in a companys marketing communications mix.

Question:

Expert Answer:

i Sales Promotion Sales promotion covers those showcasing exercises other than publicizing exposure and individual selling that animate shopper buying ... View the full answer

Global Business

Students also viewed these marketing questions