The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved
Question:
The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved with trypsin with chymotrypsin?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 80% (10 reviews)
Trypsin cleaves peptide bonds at the carboxyl side of ...View the full answer
Answered By
John Kimutai
I seek to use my competencies gained through on the job experience and skills learned in training to carry out tasks to the satisfaction of users. I have a keen interest in always delivering excellent work
4.70+
11+ Reviews
24+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Angiotensin II is an octapeptide with vasoconstrictor activity. Complete hydrolysis gives one equivalent each of Arg, Asp, His, Ile, Phe, Pro, Tyr, and Val. Reaction with Sanger's reagent gives,...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe that the DNA contained a transposable element?
-
Design a disc brake with a double caliper. Each side of the disc has two 40-mm-diameter pads. The center of the brake pads is at a radius of 150 mm. The outside diameter of the disk is 360 mm. The...
-
If your social media monitoring efforts pick up a tweet that accuses your customer service staff of lying and claims to have evidence to back it up, how would you respond?
-
Midwest Manufacturing purchased a three- year insurance policy for $ 30,000 on January 2, 2015. Prepare any journal entries, adjusting journal entries, and closing journal entries required on January...
-
What was the importance of the Big Bang?
-
Martin Company is considering the introduction of a new product. To determine a selling price, the company has gathered the following information: Required: The company uses the absorption costing...
-
Match the description of the data standard to each of the current audit data standards: Shipments to Customers Answer 1 Question 1 Choose... Chart of Accounts Answer 2 Question 1 Choose... File...
-
The probability distribution of the weekly demand for copier paper (in hundreds of reams) used in the duplicating center of a corporation is provided in the file S04_58.xlsx. Assuming that it costs...
-
Show the structures of the products obtained on reaction of valine with ninhydrin.
-
What is the N-terminal residue on a peptide that gives the following PTH derivative on Edmandegradation?
-
For the following exercises, given each set of information, find a linear equation satisfying the conditions, if possible. Passes through (1, 5) and (4, 11)
-
Devon Corporation, which manufactures hand - made wooden toys, entered into the following transactions during January, its first month of operations:a . Purchased 5 , 0 0 0 pounds of direct materials...
-
Draw a correctly labeled short-run aggregate demand and supply graph showing the equilibrium real GDP and price level, labeled Y, and P1. a. Show the effect of depreciation of the domestic currency..
-
3. Suppose the market is wild; it is modeled by . (a) What is the value of a Call? (b) What is the value of a Put? (c) Explain both answers in terms of finance.
-
Jurvin Enterprises is a manufacturing company with no beginning inventories. A subset of the transactions it recorded during a recent month is shown below. a. Purchased $94,000 in raw materials for...
-
if f ( x ) = x + sinx , then f ' ( x ) =
-
Derive Equation 11.35a. = 1 exp(-NTU) (11.35a)
-
Distinguish among total-moisture content, free-moisture content, equilibrium-moisture content, unbound moisture, and bound moisture.
-
Carbon dioxide dissolves in water according to the equations: Carbon dioxide levels in the atmosphere have increased about 20% over the last century. Given that Earths oceans are exposed to...
-
How many hydrogens are replaced by deuterium when each of the following compounds is treated with NaOD in D2O? a. 3-methylcyclopentanone b. 3-methylhexanal
-
As described in "A Word About . . . Water Treatment and the Chemistry of Enols/Enolates," carbonyl compounds can become halogenated by treatment with a base and a halogen source, such as Cl2....
-
Write out the steps in the mechanism for the aldol condensation of butanal (the first step in the synthesis of the mosquito repellent "6-12," eq. 9.57).
-
Part 1: Present Value of a Series 1. Consider an ordinary annuity in which you receive annual payments of $1,000 at the end of each year for the next five years. Assume the discount rate is 3%. a....
-
Pete Air wants to buy a used Jeep in 5 years. He estimates the Jeep will cost $15,300. Assume Pete invests $10,300 now at 10% interest compounded semiannually. a. Calculate the maturity value of the...
-
Cost- Volume- Profit- Analysis and Break-Even 1. A firm manufactures a product that sells for $1515 per unit. Variable cost per unit is $5 and fixed cost per period is $1500. Capacity per period is...
Study smarter with the SolutionInn App