What amino acid sequence is coded for by the following DNA coding strand? (5) CTT-CGA-CCA-GAC-AGC-TTT (3)
Question:
What amino acid sequence is coded for by the following DNA coding strand?
(5’) CTT-CGA-CCA-GAC-AGC-TTT (3’)
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 84% (13 reviews)
DNA coding strand 53 mRNA 53 Amino acid sequence CTTCGACCAGA...View the full answer
Answered By
Branice Buyengo Ajevi
I have been teaching for the last 5 years which has strengthened my interaction with students of different level.
4.30+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
2- A rigid tank contains 0.5 kg of oxygen (O,) initially at 30 bar and 200 K. The gas is cooled and the pressure drops to 20 bar. Determine the volume of the tank, in m', and the final temperature,...
-
What amino acid sequence is coded for by the following mRNA base sequence? (5) CUA-GAC-CGU-UCC-AAG-UGA (3)
-
What amino acid sequence is coded by the following mRNA base sequence? CUU-AUG-GCU-UGG-CCC-UAA
-
Molly earns a gross yearly salary of $132,676. She has no dependent children and made the following tax deductible purchases: Charitable contributions: $5,401 Student loan interest: $1,429 When she...
-
1. Why did the government and consumers have regulatory opposition to the proposed merger and acquisition to the proposed merger between Comcast and Time Warner? 2. Why would Comcast's partnership...
-
Although the elements of copywriting differ greatly for print and television ads, integrated brand promotion campaigns use both print and broadcast media alike to deliver consistent brand messages....
-
A public accounting firm has been engaged to perform the audit of a local, federally funded Housing Allowance Program. The objective of the program is to increase the housing standards of Agana...
-
Dresser, Inc., manufactures three super-sports-hero dolls: Super Dunk, Pete Tulip, and Zonk. Production, however, is limited by the skilled labor necessary to produce these unique dolls. Data on each...
-
The Institute of Business Ethics states that its role is to: "... raise public awareness of the importance of doing business ethically... and to help organisations to strengthen their ethics culture...
-
Dominique Fouque owns and operates Dominique's Doll House. She has a small shop in which she sells new and antique dolls. She is particularly well known for her collection of antique Ken and Barbie...
-
Give an mRNA sequence that will code (or the synthesis of angiotensin II. Asp-Arg-Val-Tyr-IIe-His-Pro-Phe
-
If the DNA coding sequence CAA-CCG-GAT- were miscopied during replication and became -CGA-CCG-GAT-, what effect would there he on the sequence of the protein produced?
-
In Problem write the expression as a quotient of integers, reduced to lowest terms. 2 9. 2 1 9.
-
The monetary policy rule discussed in class specifies that the real interest rate depends on the difference between actual and target rates of price inflation (among other things). In the real world,...
-
Kay is willing to buy four cars at their current price. However, based on her income, she is only able to afford two cars. What is the quantity demanded? Explain Briefly?
-
It may seem as though basic static games are too simple to describe the strategic choices faced by modern transnational firms. Yet simple normal-form games apply to the case studies presented in both...
-
What factors act to constrain the strategy of producing goods in one country for shipment to markets in another. Explain These Factors briefly?
-
Company: ShareCare What is the value proposition? Company: Genomind What is the revenue model? How does it disrupt the healthcare business enviroment? NO PAPER WORK ONLY TYPED ANSWERS ASAP
-
David Samarin, network administrator for OrangeWerks, laced his shoes as he prepared to head out for his exercise break in Ottawa. It was February 7, 2011, and Samarin needed to decide what to do...
-
The figure shows a bolted lap joint that uses SAE grade 8 bolts. The members are made of cold-drawn AISI 1040 steel. Find the safe tensile shear load F that can be applied to this connection if the...
-
Ammonia is to be isothermally compressed in a specially designed flow turbine from 1 bar and 100C to 50 bar. If the compression is done reversibly, compute the heat and work flows needed per mole of...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
Write the structure for a. dCMP b. dGMP
-
What products would you expect to obtain from the complete hydrolysis of NAD? See page 547 for its structure.
-
Drilling Company uses activity-based costing and provides this information: Driver Rate Manufacturing Activity Cost Driver Materials handling Number of parts $ 0.60 Machinery Number of machine hours...
-
You are hoping to implement a project to distribute free fertilizer to farmers. In the current year (year 0), there will be an upfront administrative cost of $200 of setting up the program. Then,...
-
A owns ABC, Inc., an S corporation. A's stock basis was $10,000 at the beginning of year 1 and he loaned ABC $3,000 on Jan. 1. ABC has loss of $15,000 for the year. 30. How much of the loss can A...
Study smarter with the SolutionInn App