Give an mRNA sequence that will code (or the synthesis of angiotensin II. Asp-Arg-Val-Tyr-IIe-His-Pro-Phe
Question:
Give an mRNA sequence that will code (or the synthesis of angiotensin II.
Asp-Arg-Val-Tyr-IIe-His-Pro-Phe
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 77% (9 reviews)
Angiotensin II Asp ArgVal TyrIle His Pro Phe stop m...View the full answer
Answered By
Joseph Mwaura
I have been teaching college students in various subjects for 9 years now. Besides, I have been tutoring online with several tutoring companies from 2010 to date. The 9 years of experience as a tutor has enabled me to develop multiple tutoring skills and see thousands of students excel in their education and in life after school which gives me much pleasure. I have assisted students in essay writing and in doing academic research and this has helped me be well versed with the various writing styles such as APA, MLA, Chicago/ Turabian, Harvard. I am always ready to handle work at any hour and in any way as students specify. In my tutoring journey, excellence has always been my guiding standard.
4.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly- Phe-Met
-
The octapeptide angiotensin II has the sequence Asp-Arg-Val-Tyr-IIe-His-Pro-Phe. What fragments would result if angiotensin II were cleaved with trypsin with chymotrypsin?
-
The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU,UUC Asp: GAU, GAC These sequences are complementary to the sequences...
-
B-bol King Co. started a new promotional program. For every 10 box tops returned, customers receive a basketball. The entity estimated that only 60% of the box tops reaching the market will be...
-
How can the resource-based view of the firm (see Chapters 1 and 3) help us understand why firms develop and use cooperative strategies such as strategic alliances and joint ventures?
-
The creative director in any agency has the daunting task of channeling the creative energies of dozens of individuals, while demanding team accountability. If the expression of creativity is...
-
As a GAO auditor, you have been assigned to perform an audit of a Department of Education School Breakfast Program. The Department had instructed all schools to order commodities in economical...
-
Amber Company produces electronic fish finders. It makes two different fish finders: the standard model, which is produced in bulk and sells for $200, and the deluxe model, which comes in various...
-
A piece of equipment costs $80,000 with a depreciation period of 3 years. The installations are $20,000. The recovery percentages are 33%,45%,15 %, and 7% for yera1 to 4, respectively. The...
-
Top Quality ApplianceLong Beach has just purchased a franchise from Top Quality Appliance (TQA). TQA is a manufacturer of kitchen appliances. TQA markets its products via retail stores that are...
-
Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was transcribed. Problem 28.24 UAC is a codon for tyrosine it was transcribed from ATG of...
-
What amino acid sequence is coded for by the following DNA coding strand? (5) CTT-CGA-CCA-GAC-AGC-TTT (3)
-
Which of the following is not an isotope of hydrogen? a. 1 0 H b. 1 1 H c. 2 1 H d. 3 1 H
-
What are the three kinds of examples we can use in "Supporting your ideas"? How might you use each kind to support your ideas? What are five tips for using examples in your speeches?
-
https://youtu.be/49B2_tcNbRs?si=okAll5NlpmkfEgbJ How coalitions work in child custody situations (how they change, how they don't work, how they do work). Connect emotional escalation to the child...
-
Make a Proposal Essay or Proposal Presentation about Business and how you will become a successful businessman in life. Include citations using the APA style 7th edition. Intellectual theft will not...
-
Doctoral learners must understand the nature of a researchable dissertation topic and how the variety of available research literature leads to the illumination of a manageable research topic for the...
-
Describe the problem, and then explain how you would narrow down your selection of approaches to solve the problem.? what type of model you recommend and which techniques you would select. Why would...
-
Canadian Broadcasting Corporation (CBC) journalist Stephen Smart didnt anticipate that getting married would get him in hot water with his employer. However, Smart, a reporter in the British Columbia...
-
The power company must generate 100 kW in order to supply an industrial load with 94 kW through a transmission line with 0.09 resistance. If the load power factor is 0.83 lagging, find the...
-
The divided tank of the preceding problem is replaced with two interconnected tanks of equal volume; one tank is initially evacuated, and the other contains methane at 500 bar and 20C. A valve...
-
Consider Table 18.2. Will any changes occur in the resultant biosynthesized protein by a purine purine mutation in the third base of a codon? In a pyrimidine pyrimidine mutation in the third base of...
-
From Table 18.2, are mutations in the first or second base of a codon more or less serious than mutations at the third base? Table 18.2The Genetic Code; Translation of the Codons into Amino Acids...
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
You are the Senior Manager of IAuditYou LLP, you were recently assigned to take over a very important client for the company, The engagement partner, Max Roff, has been the audit partner for the past...
-
The issues we face towards building a sustainable and just world run according to the principles by Ostrom are due to several factors but mainly the desire for humanity to develop economically at all...
-
The year of the pandemic, 2020, had just wound down, and there was an air of relief mixed with...
Study smarter with the SolutionInn App