Write a structural formula for each of the following compounds, using a line to represent each single bond and dots for any unshared electron pairs: a. CH3OH b. CH3CH2Cl c. C3H8 d. CH3CH2NH2 e. C2H5F...
An abbreviated formula of 2-heptanone is shown in Figure 1.12. a. How many carbons does 2-heptanone have? b. What is its molecular formula? c. Write a more detailed structural formula for it.
Add curved arrows to the following structures to show how electron pairs must be moved to interconvert the structures, and locate any formal charges. O-H -H
Add curved arrows to show how electrons must move to form the product from the reactants in the following equation, and locate any formal charges. :0 O: HO CH
Another puckered conformation for cyclohexane, one in which all C-C-C angles are the normal 109.5°, is the boat conformation. Explain why this conformation is very much less stable than the chair...
Account for the experimental observation that small amounts of ethane and chloroethane are produced during the monochlorination of methane.
Write structural formulas for the following compounds: a. 2-methylhexane b. 2,3-dimethylbutane c. 4-ethyl-2,2-dimethylheptane d. 2-bromo-4-methyloctane e. 1,1-diiodocyclobutane f. 2-chlorobutane g....
Write expanded formulas for the following compounds and name them using the IUPAC system: a. (CH3)3CCH2CH2CH3 b. CH3(CH2)2CH3 c. (CH3)2CHCH2CH2CH3 d. CH3CCl2CF3 e. (CH2)4 f. CH3CH2CHFCH3 g. EtBr h....
Give an IUPAC name for the following compounds: q, b.CH,CH2CHCH, c' .CH,HCHCH, CH3 CH,--C-CH3 CH3 ,
Draw the tetra-ethyl analog of 2,2-dimethylpropane as discussed in "A Word About . . . Isomers-Possible and Impossible" on page 55. What is the correct IUPAC name for this compound? Make models of...
Arrange the following liquids in order from least soluble in hexane to most soluble in hexane: Explain your answer in terms of intermolecular interactions. a. b. C. 0
As noted in the "A Word about . . . Methane, Marsh Gas, and Miller's Experiment" on page 60, methane can be formed in muddy sediments because of the reducing environment (i.e., lack of oxygen). Write...
Write an equation for each of the following reactions: a. 2-butene + HCl b. 3-hexene + HI c. 4-methylcyclopentene + HBr
Name the following compounds by the IUPAC system: a. CH3CH=C(CH2CH2CH3)2 b. (CH3)2CHCH"CHCH3 c. g. CH3-C-C-CH-CH, h. k.
a. What are the usual lengths for the single (sp3-sp3), double (sp2-sp2), and triple (sp-sp) carbon-carbon bonds? b. The single bond in each of the following compounds has the length shown. Suggest a...
Adding 1 mole of hydrogen chloride (HCl) to 1,3-octadiene gives two products. Give their structures, and write all of the steps in a reaction mechanism that explains how each product is formed.
As discussed in "A Word About . . . Ethylene" on pp. 98-99, 2-chloroethylphosphonic acid, ClCH2CH2PO(OH)2, is a commercially synthesized compound that is used for inducing the ripening of fruit. a....
As discussed in "A Word About . . . Petroleum, Gasoline, and Octane Number" on p. 103, isomerization is often used to convert one alkane to a more substituted alkane. Suggest the highly branched...
There are three dibromobenzenes (o-, m-, and p-). Suppose we have samples of each in separate bottles, but we don't know which is which. Let us call them A, B, and C. On nitration, compound A (mp...
For each of the monosubstituted benzenes shown below, (1) Indicate whether the substituent is ortho, para directing or meta directing. (2) Draw the structure of the main monosubstitution product for...
As discussed in "A Word About . . . Vitamin E-Tocopherols and Tocotrienols" on page 128, these compounds can be obtained from different sources. How would you convert a-tocotrienol to a-tocopherol?
For the compounds named below, (1) draw the structure of each compound. (2) using benzene or toluene as the only aromatic starting material, devise a synthesis of each compound. a. P-bromotoluene b....
Tell whether the stereogenic centers marked with an asterisk in the following structures have the R or the S configuration: a. b. c. CH H H CH(CH3)2 (-)-menthone (found in peppermint) CO,H CH OH...
Name the following compounds, using E-Z notation: a. b. c. d.
Methoprene (marketed as Precor), an insect juvenile hormone mimic used in flea control products for pets, works by preventing the development of flea eggs and larvae. The effective form of...
(+)- and (-)-Carvone [see Problem 5.37 for the structure of (+)-carvone] are enantiomers that have very different odors and are responsible for the odors of caraway seeds and spearmint, respectively....
As discussed in the "A Word About . . . Green Chemistry: L-DOPA", the (R,R) DiPAMP phosphine ligand was used to prepare the precursor to L-DOPA. What is the absolute configuration, R or S, of the...
As discussed in the "A Word About . . . Pasteur's Experiments and the van't Hoff-LeBel Explanation", a critical experiment and observation made by Pasteur was that when he dissolved pure forms of the...
Assign a priority order to each of the following sets of groups: a. -CH(CH3)2, -CH3, -H, -NH2 b. -OH, -Br, -CH3, -CH2OH c. -OCH3, -NH(CH3)2, -CH2NH2, -OH d. -CH2CH2CH3, -CH2CH3, -C(CH3)3, -CH(CH3)2
Assign a priority order to a. -C¡CH and -CH=CH2 b. -CH=CH2 and c. -CH=O, -CH=CH2, -CH2CH3, and -CH2OH
A South Korean research group has isolated and synthesized "daumone," the pheromone that induces hibernation in Caenorhabditis elegans worms when food becomes scarce, thus extending their life span...
Using Table 6.1, write complete equations for the following nucleophilic substitution reactions: a. Na+-OH + CH3CH2CH2Br b. (CH3CH2)3N: + CH3CH2Br c. Nat SH+ CH Br Table 6.1 Reactions of Common...
Draw each of the following equations in a way that shows clearly the stereochemistry of the reactants and products. a. (R)-2-bromobutane sodium methoxide (in methanol)2-methoxybutane b....
Determine the order of reactivity for (CH3)2CHCH2Br, (CH3)3CBr, and in substitution reactions with a. Sodium cyanide. b. 50% aqueous acetone. CH CHCH2CH3 Br
Provide equations for the synthesis of the following compounds from 1-bromo-1-phenylethane. OCH2CH N(CH3)2 a. b. C. d. e.
Combine the reaction in eq. 3.53 with a nucleophilic substitution to devise a. A two-step synthesis of b. A four-step synthesis of CH3C¡CCH2CH3 from acetylene and appropriate alkyl halides....
Arrange the following compounds in order of decreasing SN2 reactivity toward sodium ethoxide: CH3 CH3 CH3CH2CHB CH CHCH2Br CH,CH2CH2CH2Br
Write a structural formula for each of the following compounds: a. 1-methylcyclohexanol b. p-bromophenol c. 2,3-butanediol d. 2,2-dimethyl-1-butanol e. sodium ethoxide f. cis-2-methylcyclopentanol g....
Name each of the following compounds: a. HOCH2CH(OH)CH(OH)CH2OH b. (CH3)3CO-K+ c. d. e. f. g. CH3CH = CHCH2OH h. i. CH3CH2CH(OH)CH3 j. CH3CHBrC(CH3)2OH OH Br ,
Show the structures of all possible acid-catalyzed dehydration products of the following. If more than one alkene is possible, predict which one will be formed in the largest amount. a....
Although the reaction shown in eq. 7.26 occurs faster than that shown in eq. 7.28, the yield of product is lower. The yield of t-butyl chloride is only 80%, whereas the yield of n-butyl chloride is...
The disulfide shown below is a component of the odorous secretion of mink. Describe a synthesis of this disulfide, starting with 3-methyl-1-butanol. O o
Write an equation for the reaction of cyclohexene with m-chloroperbenzoic acid, C-O-O-H Cl
Design a synthesis of 3-pentyn-1-ol using propyne and ethylene oxide as the only sources of carbon atoms.
An organic compound with the molecular formula C4H10O3 shows properties of both an alcohol and an ether. When treated with an excess of hydrogen bromide, it yields only one organic compound, 1,...
Write an equation for the synthesis of propyl ether from 1-propanol.
Write the structure of the mixed aldol obtained from propanal and benzaldehyde. What structure is obtained from dehydration of this mixed aldol?
The boiling points of the isomeric carbonyl compounds heptanal, 4-heptanone, and 2,4-dimethyl-3-pentanone are 155C, 144C, and 124C, respectively. Suggest a possible explanation for the observed order.
Write an equation for the reaction of each of the following with ethylmagnesium bromide, followed by hydrolysis with aqueous acid: a. Formaldehyde b. Hexanal c. Acetophenone d. Ethylene oxide e....
Complete the equation for the reaction of H,O KOH a. cyclohexanone+ NaCCHb cyclopentanone HCN c. 2-butanone +NH2OH e. propanal + phenylhydrazine d. benzaldehyde +benzylamine
As described in "A Word About . . . Water Treatment and the Chemistry of Enols/Enolates," carbonyl compounds can become halogenated by treatment with a base and a halogen source, such as Cl2....
Arrange benzaldehyde (mol. wt. 106), benzyl alcohol (mol. wt. 108), and p-xylene (mol. wt. 106) in order of a. Increasing boiling point b. Increasing water solubility
Write an equation for the reaction of the hemiacetal with excess ethanol and H+. Show each step in the mechanism.
a. Name (CH3)2CHCH2CONH2 b. Write the structure of 1-phenylcyclopentanecarboxamide
Write a structural formula for each of the following acids: a. 4-ethylhexanoic acid b. 2-bromobutanoic acid c. 3-chlorohexanoic acid d. cyclopentanecarboxylic acid e. 2-isopropylbenzoic acid f....
In each of the following pairs of acids, which would be expected to be the stronger acid, and why? a. ClCH2CO2H and BrCH2CO2H b. o-BrC6H4CO2H and m-BrC6H4CO2H c. Cl3CCO2H and F3CCO2H d. C6H5CO2H and...
Starting from bromobenzene, provide a short synthesis of methyl benzoate (C6H5CO2CH3).
Write an equation for the reaction of propyl benzoate with a. Hot aqueous sodium hydroxide b. Ammonia (heat) c. Phenylmagnesium iodide (two equivalents), then H3O+ d. Lithium aluminum hydride (two...
Considering the relative reactivities of ketones and esters toward nucleophiles, which of the following products seems the more likely? CH2CH2000,CH3Mit NaBH CH CCH,CH2CH2OH or CH,CHCH,CH2CO-CH
Mandelic acid, which has the formula C6H5CH(OH)COOH, can be isolated from bitter almonds (called mandel in German). It is sometimes used in medicine to treat urinary infections. Devise a two-step...
Analogous to the mixed aldol condensation (Sec. 9.18), mixed Claisen condensations are possible. Predict the structure of the product obtained when a mixture of ethyl benzoate and ethyl acetate is...
As noted in the "A Word About Thioesters, Nature's Acyl-Activating Groups" on page 312, biological systems rely on thioesters for acyl transfer, but thioesters can be exploited in the laboratory as...
Account for the relative acidities of benzoic acid and its ortho, meta, and para chloro derivatives.
(5R,6S)-6-Acetoxy-5-hexadecanolide is a pheromone that attracts certain disease-carrying mosquitoes to sites where they like to lay their eggs. Such compounds might be used to lure these insects away...
Write a correct name for each of the following compounds: a. b. CH3NHCH2CH2CH3 c. (CH3CH2)2NCH3 d. (CH3)4N+ Cl- e. CH3CH(OH)CH(NH2)CH3 f. g. h. i. j. H2N(CH2)6NH2 Cl NH2 Cl 0
Tell which is the stronger base and why. a. Aniline or p-cyanoaniline b. Aniline or diphenylamine
Give equations for the preparation of the following amines from the indicated precursor: a. N,N-diethylaniline from aniline b. m-bromoaniline from benzene c. p-bromoaniline from benzene d....
Complete the following equations: a. b. c. d. e. NH CH CHCH,Brhet LiALH CH,CCl +H,NCH CH CH(CH)2~ A LiAIH C excess HONO CH OC LiAIH NaBH,CN
As noted in the "A Word About . . . Alkaloids and the Dart-Poison Frogs" on page 341, many alkaloids have potent efficacy with regard to disrupting neurological function. Methamphetamine...
Acetylcholine is synthesized in the body's neurons. The enzyme choline acetyltransferase catalyzes its synthesis from acetyl-CoA (see "A Word About . . . Thioesters, Nature's Acyl-Activating Groups"...
Write an equation for the reaction of with a. HBF4, then heat b. aqueous acid, heat c. KCN and cuprous cyanide d. p-methoxyphenol and HO2 e. HCl and cuprous chloride f. N,N-dimethylaniline and base...
A particular solution of the ketone whose spectrum is shown, placed in a 1-cm absorption cell shows a peak at λmax 5 232 nm with an observed absorbance A = 2.2. Calculate the...
An alkane shows an M+. peak at m/z 114. What is its molecular formula? What will be the relative intensities of the 115/114 peaks?
A very dilute solution of ethanol in carbon tetrachloride shows a sharp IR band at 3580 cm-1. As the solution is made more concentrated, a new, rather broad band appears at 3250 cm1 to 3350 cm-1....
An alcohol, C5H12O, shows a daughter ion peak at m/z 5 59 in its mass spectrum. An isomeric alcohol shows no daughter ion at m/z 5 59 but does have a peak at m/z 5 45. Suggest possible structures for...
An ester is suspected of being either or Its 1H NMR spectrum consists of two peaks at δ 0.9 and δ 3.6 (relative areas 3:1). Which compound is it? Describe the spectrum that...
As discussed in the "A Word About . . . NMR in Biology and Medicine" on page 368, MRI typically uses 1H NMR spectra of water in various tissues. What is the disadvantage of using 13C NMR spectra?...
Write an equation for the reaction of pyridine with a. cold sulfuric acid (H2SO4) b. cold nitric acid (HNO3)
Although nitration of pyridine requires a temperature of 300°C (eq. 13.2), 2,6 dimethylpyridine is readily nitrated at 100°C. Write an equation for the reaction, and explain why milder...
Write an equation for each of the following reactions: a. Quinoline (page 395) + HCl b. Nitration of quinoline c. Quinoline + NaNH2 d. Quinoline + phenyllithium e. Quinoline + CH3I
Although electrophilic substitution occurs at C2 in pyrrole, it occurs predominantly at C3 in indole. Suggest an explanation.
As we saw in Chapter 10 in "A Word about . . . Green Chemistry" (page 299), ionic liquids are used as alternatives for other organic solvents. Suggest a synthetic scheme to prepare...
Although propylene can be polymerized with a free-radical initiator, the molecular weight of the polymer is never very high by this method because chain transfer from the methyl group of propylene...
As discussed in "A Word About . . . Degradable Polymers" (p. 426), some polymers can be naturally recycled in the environment. One can also imagine an application in drug delivery by the slow...
As discussed in "A Word About Polyacetylene and Conducting Polymers" (p. 421), thin films of all-cis or all-trans polyacetylene have different appearances, being coppery or silvery, respectively....
As discussed in "A Word About Aramids, the Latest in Polyamides", Nomex is similar in structure to Kevlar (Figure 14.3), except that Nomex is prepared from meta- rather than para-oriented monomers....
A synthetic detergent widely used in dishwashing liquids has the structure CH3(CH2)11(OCH2CH2)3OSO3 -Na+. Write a series of equations showing how this detergent can be synthesized from...
Androstenedione is a steroid touted for its muscle-building ability through metabolic conversion to testosterone (page 456). What reaction must occur in the body to convert androstenedione to...
Although -d-glucose is a reducing sugar, methyl -d-glucopyranoside (eq. 16.13) is not. Explain.
Although d-galactose contains five stereogenic centers (in its cyclic form) and is optically active, its oxidation with nitric acid gives an optically inactive dicarboxylic acid (called galactaric or...
An important portion of bacterial cell walls is a disaccharide in which C-1 of N acetylglucosamine (Sec. 16.16) is linked to the C-4 oxygen of N-acetylmuramic acid by a b-glycosidic bond. Draw the...
Aspartame has the S configuration at each of its two stereogenic centers (see "A Word about Sweetness and Sweeteners," page 479). Draw a structure of aspartame that shows its stereochemistry.
As described in "A Word About . . . Green Chemistry: Alternative Uses for Carbohydrates" (page 484), succinic acid can be prepared enzymatically from renewable resources, such as glucose. Suggest a...
Arginine shows three pKa's: at 2.17 (the --COOH group), at 9.04 (the --N1H3 group), and at 12.48 (the guanidinium ion). Write equilibria (similar to eq. 17.6) for its dissociation. At approximately...
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
How many valence electrons does carbon have?
A pentapeptide was converted to its DNP derivative, then completely hydrolyzed and analyzed quantitatively. It gave DNP-methionine, 2 moles of methionine, and 1 mole each of serine and glycine. The...
Angiotensin II is an octapeptide with vasoconstrictor activity. Complete hydrolysis gives one equivalent each of Arg, Asp, His, Ile, Phe, Pro, Tyr, and Val. Reaction with Sanger's reagent gives,...
Among the following four structures, one is not a permissible resonance form. Identify the wrong structure. Why is it incorrect? CH2-N-O: 0: CH,-N-0: CH3 CH3 CH3 CH3
(a) Write a Lewis structure for sulfur dioxide in which the octet rule is satisfied for all three atoms. Show all electron pairs and include any formal charges. The atoms are connected in the order...