If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not

Question:

If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed?
A. RNA polymerase I
B. RNA polymerase II
C. RNA polymerase III

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Genetics Analysis And Principles

ISBN: 9780073525341

5th Edition

Authors: Robert Brooker

See More Books

Question Posted: May 17, 2016 05:20 AM

See More Questions

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
Compare and contrast the activity of DNA and RNA polymerases. What is the function of each? What are the substrates of each? What is the main difference in the behavior of the two polymerases?
Two preparations of RNA polymerase from E. coli are used in separate experiments to catalyze RNA synthesis in vitro using a purified fragment of DNA carrying the argH gene as template DNA. One...
You are currently a managing partner at Innovative Marketing Solutions (IMS) a social media marketing start-up. The firm occupies a modern office space at the London Roundhouse (a hub for tech...
A pharmaceutical company has a monopoly on a new medicine. Under pressure by regulators and consumers, the company is considering lowering the price of the medicine by 10 percent. The company has...
WHAT IF THE FACTS WERE DIFFERENT? Suppose that Salmon had disclosed Gerrys proposal to Meinhard, who had said that he was not interested. Would the result in this case have been different? Explain....
A sample of 10,001 federal income tax returns with errors has been collected by the Internal Revenue Service (IRS) for analysis. A portion of the data is shown in the table below, and the full data...
The State of Ohio decides that Ohio's landfills are becoming too full at too rapid a pace, so it passes a law banning the import of waste generated out of state. Several landfill operators have...
Find the amount in the account after $400 is invested for 1 year at 8% compounded $ 432
Acme Aviation (AA) entered into an agreement with the Fast Deliveries (FD) for AA to fly packages for FD on an "as needed" basis. The agreement was for three years. After the first year, AA was not...
Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent p-independent termination? B. What types...
What sequence elements are found within the core promoter of protein-encoding genes in eukaryotes? Describe their locations and specific functions.
Should the rapid increase in world population be of concern to the average citizen in the United States? Why or why not?
What is meant by the terms income inequality and income distribution?
Can two countries gain from trade if the opportunity cost ratios relating to the production of goods they can both produce is the same? Explain.
Why is technological progress important in improving growth rates in any economy?
Why is an understanding of belief systems important in assessing approaches to dealing with poverty and inequality?
What is the steady-state equilibrium?
What are the different levels of structure of a material?
A Firm intends to invest some capital for a period of 15 years; the Firm's Management considers three Options, each consisting of purchasing a machinery of a specific brand, different for each...
Why did the incidence of gonorrhea rise dramatically in the mid-1960s, while the incidence of syphilis actually decreased at the same time?
For the sexually transmitted infections of chlamydia, herpes, and human papillomavirus, describe the organism that causes each. In each case, is treatment possible, and if so, is it an effective...
Describe how human immunodeficiency virus (HIV) effectively shuts down both humoral immunity and cell-mediated immunity. What is HAART therapy?
1. How many meters are there in 110 yards? 2. What is the equivalent length in inches of 2.5 m? 3. The weight of an object is 2.5 lb. What is the equivalent force and mass in the SI system of units?
An object is moving on a circular path of radius 3 . 0 meters at a constant speed. The time re revolution is 4 . 7 s. What is the acceleration of the object?
If the emitted infrared radiation from the asteroid Ceres, have a wavelength of maximum intensity at 20,000 nm, what is the temperature of Ceres assuming Wien's Law?

If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not

Question:

Step by Step Answer:

A Ribosomal RNA 58S 18S and ...View the full answer

Genetics Analysis And Principles

Students also viewed these Biology questions