Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the
Question:
Transcribed Image Text:
5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3 GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (8 reviews)
The top strand is the sense strand Its TATGAT segmen...View the full answer
Answered By
Kalyan M. Ranwa
I have more than seven years of teaching experience in physics and mechanical engineering.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Fundamentals of biochemistry Life at the Molecular Level
ISBN: 978-0470547847
4th edition
Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Question Posted:
Students also viewed these Medical Sciences questions
-
Shown is a representation of a DNA molecule being transcribed? a. Identify every 3² end and every 5² end in the picture. b. Identify the template strand. c. Te non template strand is also...
-
The following DNA sequence occurs in a bacterium (the promoter sequence is located to the left but is not shown). 5-CAATCATGGACTGCCATGCTTCATATGAATAGTTGACAT-3...
-
Most humans are infected with herpes simplex virus-1 (HSV-1), the causative agent of cold sores. The HSV-1 genome comprises about I 00 genes, most of which are expressed in infected host cells at the...
-
Show that 1. Every differentiable concave function is pseudoconcave. 2. Every pseudoconcave function is quasiconcave
-
Lynn bought 100 shares of Filidelphia Corporation stock for $10,000 three years ago. On December 24, she sells 50 shares for $4,000. She plans to buy 100 more shares of Filidelphia stock for $7,000...
-
(a) Find the acceleration of P.(b) Calculate the azimuthal force on a mass m located at P, and show that the result is consistent with part(a). Firans -m- Feent -mw x (w x r). Fcor = -2mw x v, dw Faz...
-
How can a corporation that has its offices out of state be served?
-
Please discuss the video "Fog of War" and proportionality in war. What was McNamara saying about proportionality during World War II? How do you think this impacted the decision making processes...
-
More Co has two divisons L & MDuring July the Cont Margin in Division L was $60,000 The Contribution margin ratio in Division M was 40% & its sales were $250,000 Division M's segment margin was...
-
Clapton Company manufactures custom guitars in a wide variety of styles. The following incomplete ledger accounts refer to transactions that are summarized for May: In addition, the following...
-
Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.
-
Why does promoter efficiency tend to decrease with the number of G C base pairs in the - 10 region of a prokaryotic gene?
-
What factor(s) caused the experiences of European and African newcomers to the United States in the period from the 1600s through the 1800s to be so different?
-
What alternatives to the exclusionary rule might be adopted to enforce the protections of the Fourth Amendment? How effective are such alternatives likely to be?
-
If college sports are a public good, what can you say about the amount of it a university will supply? What can the universitys administration do to resolve this problem?
-
Should the offense of forgery be divided into degrees based on the importance of the forged documents? If so, what criteria would you propose for the various degrees of the crime?
-
What is the rationale for excluding from trial evidence obtained in violation of the Fourth Amendment? Is this a compelling justification for the exclusion of criminal evidence from the trial of a...
-
A professional sports team refuses to hire women as executives because it feels their family duties do not allow them to devote adequate time to the team. Is this discrimination? Justify your answer.
-
Why does the absence of significant barriers to entry tend to result in a large number of suppliers?
-
1) Predict the organicproduct formed when BzCl reacts with cyclohexanol. BzCl = benzoylchloride. 2) Provide the majororganic product of the reaction below. 3) Draw the structureof the product formed...
-
Trans-2-Butene does not exhibit a signal in the double bond region of the spectrum (16001850 cm -1 ); however, IR spectroscopy is still helpful in identifying the presence of the double bond....
-
As explained previously, the concentration of an alcohol can be selected such that both a broad signal and a narrow signal appear simultaneously. In such cases, the broad signal is always to the...
-
For each of the following IR spectra, identify whether it is consistent with the structure of an alcohol, a carboxylic acid, or neither. a. b. c. d. e. f. 100- 80- 60- 40 20- 0. 2000 4000 3500 3000...
-
At January 1, 2024, M. E. Gainor Corporation had outstanding the following securities: 600 million common shares 20 million 6% cumulative preferred shares, $50 par 6.4% convertible bonds, $2,000...
-
market rate of interest. Interest is payable annually on December 31, Carr Corporation issued $45,000 of 5 percent, 9-year bonds on January 1, Year 1, for a price that reflected a 6 percent Note: Use...
-
Italian Stallion has the following transactions during the year related to stockholders' equity. February 1 Issues 5,400 shares of no-par common stock for $16 per share. May 15 Issues 600 shares of...
Study smarter with the SolutionInn App