Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms

Question:

Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:56 PM

See More Questions

In mice, the gene that encodes the enzyme inosine triphosphatase is 12 mu from the gene that encodes the enzyme ornithine decarboxylase. Suppose you have identified a strain of mice homozygous for a...
Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of...
Sec18 is a yeast gene that encodes NSF. It is a class C mutant in the yeast secretory pathway. What is the mechanistic role of NSF in membrane trafficking? As indicated by its class C phenotype, why...
Define variable. Also discuss variable initialization.
Leineia owns 1,000 shares of Serous Corporation common stock. She paid $26 per share several years ago. On December 31 of the current year, Serous distributes a $5 per share cash dividend. It reports...
Suppose the S&P 500 is at 899, and it will pay a dividend of $27 at the end of the year. Suppose also that the interest rate is 3%. If a one-year European put option has a negative time value, what...
Should we resign ourselves to the continued growth of the gig economy or fight for the right to full-time labor with benefits to and protections for workers? In Ghost Work: How to Stop Silicon Valley...
An excerpt from the Sun Company's annual report is presented below. Calculating any profit measures deemed necessary, discuss the implications of the profitability of thecompany. Sun Company Income...
Laizure Clinic uses patient - visits as its measure of activity. The clinic bases its budgets on the following information: Revenue should be $ 5 8 . 9 0 per patient - visit. Personnel expenses...
The Wiggly Piggly Grocery Company owns and operates numerous grocery stores throughout the state of Florida. It is developing plans to consolidate warehouse operations so that there will be three...
Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than about 65 bp. What is the reason for this minimum intron size?
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
To produce hot water in L.L bean's flagship store, the company recently installed a solar hot water system that will offset almost 11,000 of carbon dioxide emissions every year. suggest some of the...
An investment opportunity that will involve an investment of $1,000 will generate $300 per year for five years and then earn $140 per year forever. What is the net present value of this investment,...
If $f(x)=x^{2}+1$, find a. $f(-3)$ b. $f\left(\frac{1}{2} ight)$ c. $f(b)$
Write a program Combinations that takes an integer command-line argument $n$ and prints all $2^{n}$ combinations of any size. A combination is a subset of the $n$ elements, independent of...
The managers of a grocery store are interested in knowing how many people will shop in their store in a given hour. Suppose they collect data and find that the average number of people who enter the...
Write a complete program to create an array of Card object discussed in Sect. 5.6.2. The program should ask a user for the number of cards and using a loop to initialize each card. Perform a couple...
Funberry Amusements is an owner/operator of several amusement parks. Following is a performance report that a Funberry manager built in Excel. Using the performance report shown, answer the following...
Write a program that initializes an array. It inputs a value from the user and searches the number in the array.
An amino acid mixture consisting of lysine, leucine, and glutamic acid is to be separated by ion-exchange chromatography, using a cation-exchange resin at pH 3.5, with the eluting buffer at the same...
What is meant by salting out? How does it work?
Would you use a pH meter to monitor the progress of the reaction described in Question 14? Why or why not?
How can the circular wait condition be detected and broken to prevent deadlock in complex systems with multiple interdependent resources ?
Case Study 1\ You have been appointed as a financial analyst for the Axis International Company, a profitable retail company. The director of Finance, belonging to the capital budgeting division has...
How can I find a rival hypothesis for my current thesis of Walmart's CEO should implement intra-team communication for all associates to help with communication barriers between managers and...

Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms

Question:

Step by Step Answer:

Alternative mRNA splicing can generate different forms of th...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions