Why does promoter efficiency tend to decrease with the number of G C base pairs in
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 60% (10 reviews)
G C base pairs are more stable than A ...View the full answer
Answered By
Bhartendu Goyal
Professional, Experienced, and Expert tutor who will provide speedy and to-the-point solutions. I have been teaching students for 5 years now in different subjects and it's truly been one of the most rewarding experiences of my life. I have also done one-to-one tutoring with 100+ students and help them achieve great subject knowledge. I have expertise in computer subjects like C++, C, Java, and Python programming and other computer Science related fields. Many of my student's parents message me that your lessons improved their children's grades and this is the best only thing you want as a tea...
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Fundamentals of biochemistry Life at the Molecular Level
ISBN: 978-0470547847
4th edition
Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Question Posted:
Students also viewed these Medical Sciences questions
-
Show the ideal Rankine cycle with three stages of reheating on a T-s diagram; assume the turbine inlet temperature is the same for all stages. How does the cycle efficiency vary with the number of...
-
Show the ideal Rankine cycle with three stages of reheating on a T-s diagram. Assume the turbine inlet temperature is the same for all stages. How does the cycle efficiency vary with the number of...
-
Does a power plant that has a higher thermal efficiency necessarily have a higher second-law efficiency than one with a lower thermal efficiency? Explain.
-
In Exercises 1-2, the augmented matrix of a linear system has been reduced by row operations to the form shown. In each case, continue the appropriate row operations and describe the solution set of...
-
On November 14, 2011, Noel sells 2,000 shares of Marker, Inc., stock for $6,000. He had purchased the stock two years earlier for $10,000. Because the price of the stock continued to drop, Noel...
-
Typical backyard ants often create a network of chemical trails for guidance. Extending outward from the nest, a trail branches (bifurcates) repeatedly, with 60o between the branches. If a roaming...
-
What qualifications does an individual need to serve a summons and complaint?
-
Stewart Construction Corporation had a net income of $16,500 during 2014. In that year, the company had depreciation expense of $7,000. Accounts Receivable increased by $5,500 and Accounts Payable...
-
Marian Plunket owns her own business and is considering an investment. If she undertakes the investment, it will pay $ 3 6 comma 0 0 0 at the end of each of the next 3 years. The opportunity requires...
-
1. Weighted average and first-in, first-out (FIFO) equivalent units would be the same in a period when which of the following occurs? a. No beginning inventory exists. b. No ending inventory exists....
-
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
-
Explain why inserting 5 bp of DNA at the -50 position of a eukaryotic gene decreases the rate of RNA polymerase II transcription initiation to a greater extent than inserting 10 bp at the same site.
-
An agricultural analyst is comparing the wheat production in Oklahoma counties. The analyst claims that the variation in wheat production is greater in Garfield County than in Kay County. A sample of...
-
Is the drug court method of dealing with nonviolent drug offenders superior to the traditional methods of imposing a fine or jail term or placing the defendant on probation? Should drug courts limit...
-
What justifies the criminal law making mere possession of contraband articles illegal? Do you think this rationale extends to criminalizing the mere possession of such innocent items as a...
-
Why, according to Robinson v. California, may a person not be held criminally liable for being addicted to illicit narcotics? Is this decision distinguishable from Powell v. Texas?
-
Today many security personnel are private police, yet Fourth Amendment protection has been extended only to those searches conducted by government officials. What arguments can be made for and...
-
Is it sensible to maintain the criminal prohibitions against illicit drugs, or should these substances be legalized, carefully regulated, and their abuse dealt with through other means?
-
How is marginal revenue derived from total revenue?
-
Refrigerant R-12 at 30C, 0.75 MPa enters a steady flow device and exits at 30C, 100 kPa. Assume the process is isothermal and reversible. Find the change in availability of the refrigerant.
-
For an enzyme that displays MichaelisMenten kinetics, what is the reaction velocity, V (as a percentage of V max ), observed at the following values? (a) [S] = K M (b) [S] = 0.5K M (c) [S] = 0.1K M...
-
Determine the values of KM and Vmax for the de-carboxylation of a -keto acid given the following data. Substrate Concentration (mol L1) Velocity (mM min-1) 2.500.................. 0.588...
-
The kinetic data in the following table were obtained for the reaction of carbon dioxide and water to produce bicarbonate and hydrogen ion catalyzed by carbonic anhydrase: CO2 + H2O HCO-3 + H+ [H....
-
On January 1, 2025, Pharoah Company granted stock options to officers and key employees for the purchase of 21200 shares of the company's $1 par value common stock at $22 per share as additional...
-
Dymac Appliances uses the periodic inventory system. Details regarding the inventory of appliances at January 1, purchases invoices during the next 12 months, and the inventory count at December 31...
-
In its first five years of operations, Monster Hats reports the following net income and dividends (the first year is a net loss). Required: Calculate the balance of Retained Earnings at the end of...
Study smarter with the SolutionInn App