The average adult takes about 12 breaths per minute. As a patient inhales, the volume of air
Question:
The average adult takes about 12 breaths per minute. As a patient inhales, the volume of air in the lung increases. As the patient exhales, the volume of air in the lung decreases. For t in seconds since start of the breathing cycle, the volume of air inhaled or exhaled since t = 0 is given, in hundreds of cubic centimeters, by
(a) How long is one breathing cycle?
(b) Find A'(1) and explain what it means.
Transcribed Image Text:
(77₁) 5 A(t) = -2 cos $ -t) +2.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 90% (10 reviews)
a One cycle is completed in 6012 5 seconds b We differentiat...View the full answer
Answered By
Ashington Waweru
I am a lecturer, research writer and also a qualified financial analyst and accountant. I am qualified and articulate in many disciplines including English, Accounting, Finance, Quantitative spreadsheet analysis, Economics, and Statistics. I am an expert with sixteen years of experience in online industry-related work. I have a master's in business administration and a bachelor’s degree in education, accounting, and economics options.
I am a writer and proofreading expert with sixteen years of experience in online writing, proofreading, and text editing. I have vast knowledge and experience in writing techniques and styles such as APA, ASA, MLA, Chicago, Turabian, IEEE, and many others.
I am also an online blogger and research writer with sixteen years of writing and proofreading articles and reports. I have written many scripts and articles for blogs, and I also specialize in search engine
I have sixteen years of experience in Excel data entry, Excel data analysis, R-studio quantitative analysis, SPSS quantitative analysis, research writing, and proofreading articles and reports. I will deliver the highest quality online and offline Excel, R, SPSS, and other spreadsheet solutions within your operational deadlines. I have also compiled many original Excel quantitative and text spreadsheets which solve client’s problems in my research writing career.
I have extensive enterprise resource planning accounting, financial modeling, financial reporting, and company analysis: customer relationship management, enterprise resource planning, financial accounting projects, and corporate finance.
I am articulate in psychology, engineering, nursing, counseling, project management, accounting, finance, quantitative spreadsheet analysis, statistical and economic analysis, among many other industry fields and academic disciplines. I work to solve problems and provide accurate and credible solutions and research reports in all industries in the global economy.
I have taught and conducted masters and Ph.D. thesis research for specialists in Quantitative finance, Financial Accounting, Actuarial science, Macroeconomics, Microeconomics, Risk Management, Managerial Economics, Engineering Economics, Financial economics, Taxation and many other disciplines including water engineering, psychology, e-commerce, mechanical engineering, leadership and many others.
I have developed many courses on online websites like Teachable and Thinkific. I also developed an accounting reporting automation software project for Utafiti sacco located at ILRI Uthiru Kenya when I was working there in year 2001.
I am a mature, self-motivated worker who delivers high-quality, on-time reports which solve client’s problems accurately.
I have written many academic and professional industry research papers and tutored many clients from college to university undergraduate, master's and Ph.D. students, and corporate professionals. I anticipate your hiring me.
I know I will deliver the highest quality work you will find anywhere to award me your project work. Please note that I am looking for a long-term work relationship with you. I look forward to you delivering the best service to you.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Applied Calculus
ISBN: 9781119275565
6th Edition
Authors: Deborah Hughes Hallett, Patti Frazer Lock, Andrew M. Gleason, Daniel E. Flath, Sheldon P. Gordon, David O. Lomen, David Lovelock, William G. McCallum, Brad G. Osgood, Andrew Pasquale
Question Posted:
Students also viewed these Mathematics questions
-
An adult takes about 12 breaths per minute inhaling roughly 500mL of air with each breath. The molar compositions of the inspired and expired gases are as follows: The inspired gas is at 24?C and 1...
-
An adult takes about 12 breaths per minute, inhaling roughly 500 mL of air with each breath. The molar compositions of the inspired and expired gases are as follows: The inspired gas is at 24C and 1...
-
A random sample of 18 adult male wolves from the Canadian Northwest Territories gave an average weight 1 = 98 lb with estimated sample standard deviation s1 = 6.5 lb. Another sample of 24 adult male...
-
Rainfall of magnitude 3.8cm and 2.8cm occurring on two consecutive 4-h durations on a catchment of area 27km produced the following hydrograph of flow at the outlet of the catchment. Estimate the...
-
The Carlyle Company is in the process of preparing its manufacturing overhead budget for the upcoming year. Sales are projected to be 40,000 units. Information about the various manufacturing...
-
Find the force of attraction between two magnetic dipoles, m1 and m2, oriented as shown in Fig. 6.7, a distance r apart, (a) Using Eq. 6.2, and (b) Using Eq.6.3. m r m
-
Data relative to three sampling plans are presented below: Required: Calculate sample size in each of the plans. Show computations. Materiality Size of population Desired reliability Estimated...
-
Nelson wanted to sell his home. Baker sent him a written offer to purchase the home. Nelson made some changes to Bakers offer and wrote him that he, Nelson, was accepting the offer as amended. Baker...
-
Below is a list of four problem-solving strategies created by Dawn Allison, author of Career Planning and Personal Exploration. These problem-solving strategies can be applied to any aspect of your...
-
Differentiate the functions in Problems. Assume that A, B, and C are constants. y = t 2 + 5 ln t
-
Find the derivative. Assume that a, b, c, and k are constants. y= et 1 + ex
-
One consequence of the continual evolution of sex roles is that men are concerned as never before with their appearance. Men spend $7.7 billion on grooming products globally each year. A wave of male...
-
Simplify. 4 2 30w x 5 3 5w x
-
Apply the knowledge gained in earlier units and the first learning objective of this unit by thinking about starting a new business and how they will structure it. What are the fixed and variable and...
-
Solve: log (6x-2)-log5(-3x+7)= 2
-
Your company has purchased the Lola Bakery Company in Sebola Zambia. The company has 10 employees and the owner is retiring this week. You have been hired as the new General Manager. You have had...
-
The Rule of 70: Suppose you have a variable, called Y, that grows at a constant rate g. The value of the variable at time t + h in relation to its value at time t is then: Yt+h = (1 + g)^h * Yt This...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
MgO prevents premature evaporation of Al in a furnace by maintaining the aluminum as Al2O3. Another type of matrix modifier prevents loss of signal from the atom X that readily forms the molecular...
-
Compute a 95% CI for the difference in the proportion of women who have ever used IUDs between the infertile and fertile women in Problem 13.1? Gynecology In a 1985 study of the relationship between...
-
Use the contingency-table method to perform the test in Problem 13.1? Gynecology In a 1985 study of the relationship between contraceptive use and infertility, 89 of 283 infertile women, compared...
-
Use the contingency-table method to perform the test in Problem 13.1? Gynecology In a 1985 study of the relationship between contraceptive use and infertility, 89 of 283 infertile women, compared...
-
Manage a trust account in line with legislative requirements. Evaluate internal controls, and methods for improving revenue and performance within a real estate branch. Apply risk management...
-
Communication Foundation https://www.linkedin.com/learning/communication-foundations-2 Write about two paragraphs describing "One Day in the life of a Hanson student" as per the attached details....
-
Canada Automotive Corp., a business based in Canada, enters into distribution agreements with 3 different car dealerships in Europe, and promises them each their own exclusive territory. To ensure...
Study smarter with the SolutionInn App