Using the data below and from the literature and other valid/supportable sources, and using mass balances...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Using the data below and from the literature and other valid/supportable sources, and using mass balances for key process steps (hydrolysis, fermentation, etc.), determine the following for a plant that produces 150 million liters per year of denatured ethanol: a. How many tonnes of corn is required, if corn contains 70% starch (dry basis)? b. How many tonnes of DDGS is produced (dry basis)? c. Compare results from (a) and (b) with process yield data in the "starch ethanol" slides. d. How much land is required for the corn, in Ha, if the corn crop yield is 160 bushels (wet) per acre e. How much land would be required grow enough corn to displace 10 vol% of the current annual U.S. gasoline consumption? (Check the EIA website for fuel consumption data) f. Cattle in a feedlot each consume about 125 bushels (wet) of feed corn annually. Alternatively, each animal may be fed about 85 bushels of feed corn and 1 ton of Dried Distiller's Grains with Solubles (DDGSs). i. How much land is required to grow enough feed corn to feed 50,000 head of cattle? ii. How much corn (and land) is required to feed 50,000 head of cattle a mixture of corn and DDGS? iii. Based on (i), (ii), and 1(c), what is the net land impact of ethanol production (e.g., in acres per million US gallons, or in Ha/L)? This takes into account land "saved" when DDGS replaces corn in animal feed. Conversion Factors and other process data: 1 acre = 0.4 Ha 1 US Gallon = 3.78 L 1 bushel = 56 lbs (corn) = 60 lbs (wheat) Corn (wet) contains 10% moisture; the price paid for corn includes the water present in the grain. DDGS (wet) contains 10% moisture. Hydrolysis converts 95% of the available starch into glucose; the balance ends up in DDGS. Don't forget to account for the 11% weight gain during hydrolysis, which inserts a water/hydroxyl molecule into each sub- unit. In other words, 1.11 kg of glucose is produced from every kg of starch converted. Fermentation converts 93% of the available glucose into ethanol and CO2, and 5% of the glucose into biomass (yeast cells). The biomass and residual (unconverted) sugar end up in the DDGS, along with unconverted starch. DDGS includes all of the non-starch materials as well. Denatured ethanol contains 98% ethanol and 2% denaturant Ethanol is 99.5% pure (balance is mainly water), prior to adding denaturant 2. Based upon your calculations in question (1), evaluate the financial case for production of ethanol from corn, as follows: a. Determine total revenues, if ethanol is priced at US$0.40 per liter (2020 average price), and DDGS are priced at 95% of the price of corn on a dry weight basis, i.e., dry kg of DDGS per dry kg of corn. Normalize total revenues on a per liter of ethanol basis. Take into account the corn prices listed in 2(b). b. Determine the cost of corn per liter of ethanol, considering corn prices of US$3.50, $4.00, $4.50, and $5.50 per bushel (wet basis). c. Estimate the cost for thermal energy per liter of ethanol, using the utility data in the slide deck, and the Henry Hub price for natural gas, multiplied by 1.5 for distribution and profit (cite date you obtained price data). d. If the aggregate cost of the remaining components (salaries, chemicals, water, interest, depreciation, etc.), is 8 cents/L, estimate the overall profit or loss for production of ethanol from corn, under the range of corn prices considered in 2(b) (illustrate graphically or using a table). Look up the current price for corn on CBOT, and comment on the likelihood that a corn ethanol plant would be profitable under the current conditions. Using the data below and from the literature and other valid/supportable sources, and using mass balances for key process steps (hydrolysis, fermentation, etc.), determine the following for a plant that produces 150 million liters per year of denatured ethanol: a. How many tonnes of corn is required, if corn contains 70% starch (dry basis)? b. How many tonnes of DDGS is produced (dry basis)? c. Compare results from (a) and (b) with process yield data in the "starch ethanol" slides. d. How much land is required for the corn, in Ha, if the corn crop yield is 160 bushels (wet) per acre e. How much land would be required grow enough corn to displace 10 vol% of the current annual U.S. gasoline consumption? (Check the EIA website for fuel consumption data) f. Cattle in a feedlot each consume about 125 bushels (wet) of feed corn annually. Alternatively, each animal may be fed about 85 bushels of feed corn and 1 ton of Dried Distiller's Grains with Solubles (DDGSs). i. How much land is required to grow enough feed corn to feed 50,000 head of cattle? ii. How much corn (and land) is required to feed 50,000 head of cattle a mixture of corn and DDGS? iii. Based on (i), (ii), and 1(c), what is the net land impact of ethanol production (e.g., in acres per million US gallons, or in Ha/L)? This takes into account land "saved" when DDGS replaces corn in animal feed. Conversion Factors and other process data: 1 acre = 0.4 Ha 1 US Gallon = 3.78 L 1 bushel = 56 lbs (corn) = 60 lbs (wheat) Corn (wet) contains 10% moisture; the price paid for corn includes the water present in the grain. DDGS (wet) contains 10% moisture. Hydrolysis converts 95% of the available starch into glucose; the balance ends up in DDGS. Don't forget to account for the 11% weight gain during hydrolysis, which inserts a water/hydroxyl molecule into each sub- unit. In other words, 1.11 kg of glucose is produced from every kg of starch converted. Fermentation converts 93% of the available glucose into ethanol and CO2, and 5% of the glucose into biomass (yeast cells). The biomass and residual (unconverted) sugar end up in the DDGS, along with unconverted starch. DDGS includes all of the non-starch materials as well. Denatured ethanol contains 98% ethanol and 2% denaturant Ethanol is 99.5% pure (balance is mainly water), prior to adding denaturant 2. Based upon your calculations in question (1), evaluate the financial case for production of ethanol from corn, as follows: a. Determine total revenues, if ethanol is priced at US$0.40 per liter (2020 average price), and DDGS are priced at 95% of the price of corn on a dry weight basis, i.e., dry kg of DDGS per dry kg of corn. Normalize total revenues on a per liter of ethanol basis. Take into account the corn prices listed in 2(b). b. Determine the cost of corn per liter of ethanol, considering corn prices of US$3.50, $4.00, $4.50, and $5.50 per bushel (wet basis). c. Estimate the cost for thermal energy per liter of ethanol, using the utility data in the slide deck, and the Henry Hub price for natural gas, multiplied by 1.5 for distribution and profit (cite date you obtained price data). d. If the aggregate cost of the remaining components (salaries, chemicals, water, interest, depreciation, etc.), is 8 cents/L, estimate the overall profit or loss for production of ethanol from corn, under the range of corn prices considered in 2(b) (illustrate graphically or using a table). Look up the current price for corn on CBOT, and comment on the likelihood that a corn ethanol plant would be profitable under the current conditions.
Expert Answer:
Answer rating: 100% (QA)
1a Corn required 150 million L ethanol per year Ethanol is 995 pure so 150 million L ethanol requires 1515 million L of 995 ethanol Fermentation conve... View the full answer
Related Book For
Posted Date:
Students also viewed these economics questions
-
The quality control manager at a plant that produces canned peaches is setting up a hypothesis test about the amount of peaches in the can. The cans are supposed to contain 142mL of peaches. a. What...
-
The quality control manager at a plant that produces bottled water is setting up a hypothesis test for the amount of water in the bottle, which is supposed to be 750 millilitres. a. What should the...
-
Using the data below (given in millions of $U.S.), compute GDP, national income, and net domestic product. Corporate profits 1,200 Gross private domestic investment 2,000 Consumption of nondurable...
-
Claud Chapperon is a self-employed distributor of wholesale clothing who began trading on 1 July 2012. His summarised accounts for the year to 30 June 2020 are shown below. The figures in brackets...
-
Students with fewer than 12 units in the current term are considered part-time. Create a new categorical variable that classifies each student in Table 1A as full-time (12 or more units) or...
-
Pacifico Company, a U.S.-based importer of beer and wine, purchased 1,500 cases of Oktoberfest-style beer from a German supplier for 390,000 euros. Relevant U.S. dollar exchange rates for the euro...
-
Myers, Montgomery and Anderson-Cook (Response Surface Methodology 4th edition, Wiley, New York, 2016) discuss an experiment to determine the influence of five factors:$x_{1}$ - acid bath temperature...
-
The production function at Ginkos Copy Shop is q = 1,000 min( L, 3K), where q is the number of copies per hour, L is the number of workers, and K is the number of copy machines. As an example, if L...
-
state the accounting investment tools any business can use and the SWOT analysis?
-
Helix Company produces costumes used in the television and movie industries. Recently the company received an ongoing order for Samurai robes to be worn in an upcoming Japanese historical action...
-
Suppose that you are working in a company as a cost manager that has two support departments and two operating departments. Determine the total department cost and allocation base for these...
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
The five basic principles are Money has a time value There is a risk return tradeoff Cash flows are the source of value Market prices reflect information Individuals respond to incentives Please...
-
(a) Given a mean free path = 0.4 nm and a mean speed vav = 1.17 105 m/s for the current flow in copper at a temperature of 300 K, calculate the classical value for the resistivity of copper. (b)...
-
What is the difference between a positive question and a normative question?
-
Why would policymakers want to drive unemployment below the natural rate, given that inflation will result?
-
Using the By the Numbers, compare the increase in the average prices of tuition at public and private colleges and universities with the increase in overall prices according to the consumer price...
-
Set out in Figure 16.10 are summarized balance sheets and income statements for F Co. for 20X1 and 20X2. You are required to: Figure 16.10 a. prepare a table of ratios, covering all aspects of...
-
Earnings is calculated deducting: A. Dividends on ordinary shares. B. Dividends on preference shares. C. Tax expense. D. Interest expense.
-
The best case study of all is probably the real-world situation. This allows you to: choose situations that are topical; choose countries that you are both knowledgeable about and interested in; ...
Study smarter with the SolutionInn App