Is myosin a fibrous protein or a globular protein? Explain.
Question:
Is myosin a fibrous protein or a globular protein? Explain.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 80% (5 reviews)
Myosin is a fibrous protein Fibrous proteins are elongated and have a structural role The...View the full answer
Answered By
Deepak Pal
Hi there! Are you looking for a committed, reliable, and enthusiastic tutor? Well, teaching and learning are more of a second nature to me, having been raised by parents who are both teachers. I have done plenty of studying and lots of learning on many exciting and challenging topics. All these experiences have influenced my decision to take on the teaching role in various capacities. As a tutor, I am looking forward to getting to understand your needs and helping you achieve your academic goals. I'm highly flexible and contactable. I am available to work on short notice since I only prefer to work with very small and select groups of students. Areas of interest: Business, accounting, Project management, sociology, technology, computers, English, linguistics, media, philosophy, political science, statistics, data science, Excel, psychology, art, history, health education, gender studies, cultural studies, ethics, religion. I am also decent with math(s) & Programming. If you have a project you think I can take on, please feel welcome to invite me, and I'm going to check it out!
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Fundamentals Of Biochemistry Life At The Molecular Level
ISBN: 9781118918401
5th Edition
Authors: Donald Voet, Judith G Voet, Charlotte W Pratt
Question Posted:
Students also viewed these Sciences questions
-
Myosin Vis an abundant nonmuscle myosin that is responsible for the transport of cargo such as organelles in many cell types. Structurally, it consists of two identical polypeptide chains that...
-
Globular proteins are typically constructed from several layers of secondary structure, with a hydrophobic core and a hydrophilic surface. Is this true for a fibrous protein such as keratin?
-
A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to gel electrophoresis in the presence of sodium dodecyl sulfate (SDS), the protein gives three bands with...
-
Each of the following passages may be plausibly criticized by some who conclude that it contains a fallacy, but each may be defended by some who deny that the argument is fallacious. Discuss the...
-
What is keystroke monitoring?
-
The apparatus shown here has two gas-filled containers and one empty container, all attached to a hollow horizontal tube. When the valves are opened and the gases are allowed to mix at constant...
-
Consider the house price data in Table B.4. a. Fit a multiple regression model relating selling price to all nine regressors. b. Test for significance of regression. What conclusions can you draw? c....
-
A tank full of water has the shape of a paraboloid of revolution as shown in the figure; that is, its shape is obtained by rotating a parabola about a vertical axis. (a) If its height is 4 ft and the...
-
A ball of mass 0,5 kg is projected vertically downwards from a height of 1,8 m with an initial velocity of 2 m.s1. The ball hits the ground and bounces two times. The position-time graph for the...
-
Rigor mortis, the stiffening of muscles after death, is caused by depletion of cellular ATP. Describe the molecular basis of rigor.
-
The force generated by a muscle fiber increases as the sarcomere shortens but decreases at very short sarcomere lengths. Explain this observation. Force (% max.) 100 75 50 25 0 1 2 3 Sarcomere length...
-
Late on a Friday afternoon, you learn that the facilities department is going to move youand your computer, your desk, and all your files to another office first thing Monday morning. However, you...
-
Let \(\tau=\inf \left\{t: M_{t}-W_{t}>a ight\}\). Prove that \(M_{\tau}\) follows the exponential law with parameter \(a^{-1}\). The exponential law stems from \[\mathbb{P}\left(M_{\tau}>x+y \mid...
-
Let \(W\) be a BM and \(\varphi\) be an adapted process. (a) Prove that \(\int_{0}^{t} \varphi_{s} d W_{s}\) is a BM if and only if \(\left|\varphi_{s} ight|=1\), ds a.s. (b) Assume now that...
-
Let \(M\) be a Gaussian martingale with bracket \(\langle Mangle\). Prove that the process \(\langle Mangle\) is deterministic. The Gaussian property implies that, for \(t>s\), the r.v....
-
Let \(T_{a}^{*}=\inf \left\{t \geq 0:\left|W_{t} ight|=a ight\}\). Using the fact that the process \(\left(e^{-\lambda^{2} t / 2} \cosh \left(\lambda W_{t} ight), t \geq 0 ight)\) is a martingale,...
-
Prove that (v) of Definition 1.4.1.1 characterizes a BM, i.e., if the process \(\left(Z_{t}=\exp \left(i \lambda X_{t}+\frac{\lambda^{2}}{2} t ight), t \geq 0 ight)\) is a \(\mathbf{F}^{X}\)-local...
-
Identify several federal agencies that participate in the enforcement of federal white- collar crime.
-
What do you think?
-
Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.
-
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
-
Why does promoter efficiency tend to decrease with the number of G C base pairs in the - 10 region of a prokaryotic gene?
-
Problem Maurice manages the file servers with Jen, and he says that one of the servers keeps running out of disk space. He needs to keep an eye on the files that are saved to the servers to make sure...
-
Lesley works for a CPA firm and is working on an audit for a large cattle ranch. She has contracted with an organization who has a drone that can fly over the ranch and count the heads of cattle for...
-
Jot java program to find if a particular element is present in a multi-dimensional array. Here is the related facts that might help to solve the problem - *************** Consider the function zarg...
Study smarter with the SolutionInn App