A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
Question:
- 5ʹCCAUCCGGCAUACCAAAUUACUAAACUAGC3ʹ-
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 50% (12 reviews)
As the mRNA is read in the 5 to the 3 direction the AUG and ...View the full answer
Answered By
Joseph Mwaura
I have been teaching college students in various subjects for 9 years now. Besides, I have been tutoring online with several tutoring companies from 2010 to date. The 9 years of experience as a tutor has enabled me to develop multiple tutoring skills and see thousands of students excel in their education and in life after school which gives me much pleasure. I have assisted students in essay writing and in doing academic research and this has helped me be well versed with the various writing styles such as APA, MLA, Chicago/ Turabian, Harvard. I am always ready to handle work at any hour and in any way as students specify. In my tutoring journey, excellence has always been my guiding standard.
4.00+
1+ Reviews
10+ Question Solved
Related Book For
Organic Chemistry A Short Course
ISBN: 978-1111425562
13th edition
Authors: Harold Hart, Christopher M. Hadad, Leslie E. Craine, David J. Hart
Question Posted:
Students also viewed these Organic Chemistry questions
-
The sequence of the sense strand of a mammalian gene is...
-
A DNA strand has the following sequence: 5'-GATCCCGATCCGCATACATTTACCAGATCACCACC-3' In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this...
-
Can a DNA strand bind to a complementary RNA strand? Explain.
-
If the molecular weight of air is 28.9, what is the density of air at atmospheric pressure and a temperature of 328.2 K? 1 atm = 1.013 x 10 5 N/m, the mass of a proton is 1.67262 x 10 -27 kg,...
-
Given MA inclined plane = length of plane / height of plane, find each missingquantity. MA Length of Plane Height of Plane 6. 9.00 7. 8. 1.30 9 10. 17.4 3.40 ft 3.79 m ft 74.0 cm in. ft 0.821 m 9.72...
-
Lockboxes and Collection time Bird's Eye Tree houses, Inc., a Kentucky company, has determined that a majority of its customers are located in the Pennsylvania area. It therefore is considering using...
-
With reference to Example 13, repeat the analysis after combining the categories below average and average in the training program and the categories poor and average in success. Comment on the form...
-
Jordan Sales Company (organized as a corporation on April 1, 2014) has completed the accounting cycle for the second year, ended March 31, 2016. Jordan also has completed a correct trial balance as...
-
Explain how the Japanese economy fell into recession in the early 1990s. Briefly analyse the reasons why monetary and fiscal policies ineffective in stimulating GDP growth and hence pulling the...
-
6. 7. 8. The lengths of various links of a mechanism, as shown in Fig. 6.32, are: OA = 0.3 m ; AB= 1 m; CD=0.8 m; and A C= CB. Determine, for the given configuration, the velocity of the slider D if...
-
From Table 18.2, are mutations in the first or second base of a codon more or less serious than mutations at the third base? Table 18.2The Genetic Code; Translation of the Codons into Amino Acids...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
Given the industry description, identify each of the following as an increasing- or constant-cost industry. a. Major League Baseball: Uses the majority of pitchers. As the number of pitchers used...
-
Use a calculator to evaluate the present value of an annuity formula \[P=m\left[\frac{1-\left(1+\frac{r}{n}ight)^{-n t}}{\frac{r}{n}}ight]\] for the values of the variables \(m, r\), and \(t\)...
-
Pab Corporation decided to establish Sollon Company as a wholly owned subsidiary by transferring some of its existing assets and liabilities to the new entity. In exchange, Sollon issued Pab 30,000...
-
Find the present value of the ordinary annuities in Problems 21-32. Amount of Deposit m 26. $100 Frequency n monthly Rate r 4% Time t 5 yr
-
A rotating flywheel is allowed to slow to a stop from a speed of \(500 \mathrm{rpm}\). While slowing, each minute it rotates two-thirds as many times as in the preceding minute. How many revolutions...
-
Write up the asset and liability and capital accounts to record the following transactions in the records of J. Beach. 2013 July 1 Started business with 62,000 in the bank. 2 Bought office furniture...
-
Find and graph all roots in the complex plane. 3 1 + i
-
Gordon and Lisa estimate that they will need $1,875,000 in 40 years for their retirement years. If they can earn 8 percent annually on their funds, how much do they need to save annually?
-
Write the structures of the cyclic acetals derived from each of the following. (a) Cyclohexanone and ethylene glycol (b) Benzaldehyde and 1, 3-propanediol (c) Isobutyl methyl ketone and ethylene...
-
Asked you to write a mechanism describing formation of benzaldehyde diethyl acetal from benzaldehyde and ethanol, write a stepwise mechanism for the acid hydrolysis of this acetal.
-
Acetal formation is a characteristic reaction of aldehydes and ketones, but not of carboxylic acids. Show how you could advantageously use a cyclic acetal protecting group in the following synthesis:
-
Pangasa Co. paid its annual worker accident insurance premium of $48,000 on its manufacturing facility in January. The company expects two worker accidents to happen during the year, and to make...
-
3. The game of baseball is often analyzed using Markov models. The state of the game can be represented by listing bases that have runners and keeping track of how many outs there are. There are...
-
Thornton Electronics currently produces the shipping containers it uses to deliver the electronics products it sells. The monthly cost of producing 9,300 containers follows. Unit-level materials...
Study smarter with the SolutionInn App