Question: An atom has energy levels En = A/n2 where n is an integer and A is a constant. Among the spectral lines that the

An atom has energy levels En = – A/n2 where n is an integer and A is a constant. Among the spectral lines that the atom can absorb at room temperature are two adjacent lines with wavelengths 97.5nm and 102.8nm. Find the value of the constant A is electron volts.

Step by Step Solution

★★★★★

3.40 Rating (156 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

An absorption line corresponds to the atom being excited from a lower to a higher energy level ie fr... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

40-P-M-P-N-P (291).docx

120 KBs Word File

Students Have Also Explored These Related Modern Physics Questions!

A hypothetical atom has energy levels uniformly separated by 1.2 eV. At a temperature of 2000 K, what is the ratio of the number of atoms in the 13th excited state to the number in the 11th excited...

Two identical cups both at room temperature are filled with the same amount of hot coffee. One cup contains a metal spoon, while the other does not. If you wait for several minutes, which of the two...

Devise a recursive algorithm for computing n2 where n is a nonnegative integer, using the fact that (n + 1)2 = n2 + 2n + 1. Then prove that this algorithm is correct.

please solve all calculations by full step and question answer. 3. Is it possible for an atom of element X to absorb Two photons and then emit ONE photon? Explain. II. Data In your laboratory...

Using "On the Spectrum of Hydrogen" by Niels Bohr -What is the main idea of the Author's argument? What is the main essence of the piece? -What ways does the author use to propose and support their...

please fill out all the questions POSTLAB - ANALYZING VISIBLE WAVELENGTH UN PEN only to fill out this form, croxy out any mistakes with a single line only DATA ANALYSIS Examine the experimental...

Introduction Celebration of holidays with fireworks illuminates the night sky with brilliant colors created by metal ions. The metals used to create fireworks are chosen to create specific colors....

Explain how the principles of quantum mechanics are able address the issues. The development of quantum mechanical theory stems from several issues that could not be addressed by the principles of...

space where an electron can be found. Bohr's most distinctive contribution was the discovery of the link between the quantized energies of electron "orbits" and the line emission spectrum. This was a...

These are a lot of questions, please take your time with each one. I will leave a good review when you are done. LEEDI'I 3: The Bohr Model of the Atom 13. What is the major problem with Rutherford's...

What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3

What is a target market? Why is it important for a firm to choose its target market early in the process of launching its venture?

1 6 If overall interest rates in the economy rise, a corporate bond with a fixed interest rate will generally Multiple Choice 0 0 0 9 1 2 decrease in value. increase in value, remain unchanged....

A string is surrounded by double quotes. True or false? C++

What escape sequence produces a tab? What escape sequence rings the bell?

Outline any information that you have shared with others, with a discussion of how this improved overall innovation. Discuss formal and informal learning opportunities that could be put in place in...

In a past presidential election, it was estimated that the probability that the Republican candidate would be elected was 2/5, and therefore the probability that the Democratic candidate would be...

Explain and discuss the presence and consequences of racial, ethnic, and gender stereotyping in the mass media.

What is the relationship between the tables Patient and Session? a. One to one b. One to many c. Many to many d. There isnt a relationship.

An aluminum cup of mass 200 g contains 800 g of water in thermal equilibrium at 80.0C. The combination of cup and water is cooled uniformly so that the temperature decreases by 1.50C per minute. At...

The relationship Lf = Li (1 + T) is an approximation that works when the average coefficient of expansion is small. If is large, one must integrate the relationship dL/dT =L to determine the final...

A steel wire and a copper wire, each of diameter 2.000 mm, are joined end to end. At 40.0C, each has an unscratched length of 2.000 m; they are connected between two fixed supports 4.000 m apart on a...

For each research situation below, identify the independent and dependent variables. Classify each in terms of the level of measurement and whether the variable is discrete or continuous. (each...

7)A political campaign wants to rent photocopiers to make leaflets for a local election. There are two suitable machines: The ACTO machine costs $120 a month to rent, occupies 2.5 square meters of...

Youve collected the following information from your favorite financial website. 52-Week Price Stock (Dividend) Dividend Yield % PE Ratio Close Price Net Change Hi Lo 77.40 10.43 Acevedo .36 2.6 6...