Diatomic chain Consider the normal modes of a linear chain in which the force constants between nearest-neighbor
Question:
Diatomic chain Consider the normal modes of a linear chain in which the force constants between nearest-neighbor atoms are alternately C and 10C. Let the masses he equal, and let the nearest-neighbor separation he a/2. Find w(K) at K = 0 and K = π/a. Sketch in the dispersion relation by eye. This problem simulates a crystal of diatomic molecules such as H2.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 85% (14 reviews)
By analogy with Eq 18 Mdudt Cv u C V U ...View the full answer
Answered By
Rodrigo Louie Rey
I started tutoring in college and have been doing it for about eight years now. I enjoy it because I love to help others learn and expand their understanding of the world. I thoroughly enjoy the "ah-ha" moments that my students have. Interests I enjoy hiking, kayaking, and spending time with my family and friends. Ideal Study Location I prefer to tutor in a quiet place so that my students can focus on what they are learning.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Solid State questions
-
(a) Describe, quantitatively and qualitatively, the normal modes of vibration for a mass-spring chain consisting of 3 unit masses, connected to top and bottom by unit springs. (b) Answer the same...
-
Give a geometrical interpretation of a linear equation in three unknowns. Give a geometrical description of the possible solution sets for a 3 3 linear system.
-
Discuss the normal modes of the system shown in Figure 12-D. L2 L1 C2 G12
-
Draw a UML Sequence Diagram for the process involved in paying a vendor for an item in cash. The process to follow is below. [15 points] a) Go to the bank b) Request your account balance c) The bank...
-
Explain what safety margin means? How can managers use this information to manage the profitability of a business?
-
Sparkle Beverages manufactures its own soda pop bottles. The bottles are made from polyethylene terephthalate (PET), a lightweight yet strong plastic. Sparkle uses as much PET recycled resin pellets...
-
Nissan is changing the design of one of its highest-selling cars, the Murano, and is conducting an internet survey to determine whether the design change would affect customer perception of the car...
-
Information related to Miracle Company for 2015 is summarized below. Total credit sales ..............$1,000,000 Accounts receivable at December 31 ...... 369,000 Bad debts written off ...............
-
Suppose that you decide to borrow 15,000 for a new car. You can select one of the following loans, each requiring regular monthly payments. Loan a four year loan at 8%. Loan B6 year loan at 10%. Find...
-
Tipton One-Slop Decorating sells paint and paint supplies, carpet, and wallpaper at a single-store location in suburban Des Moines. Although the company has been very profitable over the years,...
-
Kohn anomaly we suppose that the inter planar force constant C between planes sands + p is of the form Cp = A sin pk 0 a/pa, where A and k( are constants and p runs over all integers. Such a form is...
-
Atomic vibrations in a metal consider point ions of mass M and charge e immersed in a uniform sea of conduction electrons. The ions are imagined to be in stable equilibrium when at regular lattice...
-
Temco, Inc., conveyed to the Wynns certain property adjoining an apartment complex being developed by Sonnett Realty Company. Although nothing to this effect was contained in the deed, the sales...
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
Name two institutions that are not important financial intermediaries in an economy.
-
You are a U.S. investor who purchased British securities for 2,000 one year ago when the British pound cost U.S. $1.50. What is your total return (based on U.S. dollars) if the value of the...
-
Find the arc length function for the curve y = x 2 1/8In x taking P 0 (1, 1) as the starting point.
-
A river with a water temperature Tl = 20oC is to be used as the low temperature reservoir of a large power plant, with a steam temperature of Th = 500oC. If ecological considerations limit the amount...
-
A room air conditioner operates as a Carnot cycle refrigerator between an outside temperature Th and a room at a lower temperature T1. The room gains heat the outdoors at a rate A (Th Tl); this heat...
-
A 100 W light bulb is left burning inside a Carnot refrigerator that draws 100 W. Can the refrigerator cool below room temperature?
-
What is the worst case running time of the following sudo codes, in 0- notation? Suppose that all arithmetic operations (including simple multiplication) take a constant amount of time. Justify your...
-
4. Let G be a pseudorandom generator with expansion factor (n) > 2n. In each of the following cases, say whether G' is necessarily a pseudorandom generator and explain why or why not. Here, "||...
-
Write the code for the del () method in the following doubly linked list class public class ObjDList { private Obj Node list; private Obj Node tail; public ObjDList() { list = null; tail = null; }...
Study smarter with the SolutionInn App