Differential centrifugation, the lying (bursting) of E. coli cells has produced a dilute suspension of inclusion bodies,
Question:
Differential centrifugation, the lying (bursting) of E. coli cells has produced a dilute suspension of inclusion bodies, hard insoluble aggregates of a desired protein, unlysed cells, and unwanted dissolved proteins. For purposes of this problem all may be considered as spheres can these materials be effectively separated by centrifugation? Explain.
Transcribed Image Text:
Inclusion bodies Proteins Cells Mass or equivalent Density (g/ml) 1.89 × 10-12 g 2.32 x 10-15 g 50 kilodaltons 1.07 1.3 1.3
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 88% (9 reviews)
Differential centrifugation Yes from Eq 24422 migration velocities are proportional to Begin ...View the full answer
Answered By
Rashul Chutani
I have been associated with the area of Computer Science for long. At my university, I have taught students various Computer Science Courses like Data Structures, Algorithms, Theory of Computation, Digital Logic, System Design, and Machine Learning. I also write answers to questions posted by students in the area of and around Computer Science.
I am highly fortunate to receive great feedback on my teaching skills that keeps me motivated. Once a student sent me an email stating that I had explained to him a concept better than his professor did.
I believe in the fact that "Teaching is the best way to learn". I am highly fascinated by the way technology nowadays is solving real-world problems and try to contribute my bit to the same.
Besides tutoring, I am a researcher at the Indian Institute of Technology. My present works are in the area of Text Summarization and Signal and Systems.
Some of my achievements include clearing JEE Advanced with an All India Rank of 306 out of 1.5 million contesting candidates and being the Department Ranker 1 at my University in the Department of Computer Science and Engineering.
I look forward to providing the best Tutoring Experience I can, to the student I teach.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Chemical Engineering questions
-
In the 30 June 2020 annual report of Smith Ltd, the building was reported as follows: Building (at cost) Accumulated depreciation O The building is depreciated on a straight-line basis over a 10-year...
-
For purposes of this problem ignore the list of Legendre polynomials given on page 266 and the graphs given in Figure 6.4.3. Use Rodrigues formula (33) to generate the Legendre polynomials P 1 (x), P...
-
The genetically engineered proteins that accumulate in bacterial inclusion bodies (Fig. 5-2) form amyloid structures. Such proteins are often difficult to recover in functional form from the...
-
Assume there are 3 types of squirrels in the world (red, black, grey). Assume 40% of squirrels are black, 40% of squirrels are grey and 20% are red. Assume 3% of red squirrels are in Ontario, 2% of...
-
Diablo Company leased a machine from Juniper Corporation on January 1, 2016. The machine has a fair value of $26,000,000. The lease agreement calls for four equal payments at the end of each year in...
-
Show that the two random variables of Exercise 3.102 are not independent. In exercise A certain college gives aptitude tests in the sciences and the humanities to all entering freshmen. If X and Y...
-
An experiment involves the flow of air at atmospheric pressure and \(300 \mathrm{~K}\) over an object of characteristic length \(L=1 \mathrm{~m}\) that is coated with species A. The measured average...
-
A firm has a capital structure containing 60% debt and 40% common stock equity. Its outstanding bonds offer investors a 6.5% yield to maturity. The risk-free rate currently equals 5%, and the...
-
The income statement disclosed the following items for the year: Depreciation expense Gain on disposal of equipment Net income $40,000 23,330 344,100 The changes in the current asset and liability...
-
Mary Lavor plans to save money at her bank for use in December. She will deposit $30 a month, beginning on March 1and continuing through November 1. She will withdraw all the money on December 1. If...
-
Expressions for the mass flux (a) Show how to transform the left side of Eq. 24.2-8 into the left side of Eq. 24.2-9. First rewrite the former as follows: Rewrite the second term as a sum over all...
-
Departures from electro neutrality, following Newman, estimate the departures from electro neutrality in the stagnant region between the reservoirs of Problem 24B.2 as follows. First calculate the...
-
What is meant by the term glass ceiling? How does it affect the prospects of some people in the workforce and impact their careers? How do you think it will be shaped in the future by organizations?
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
Scientific management was led by Henri Fayol Henry Gantt F.W. Taylor Max Weber
-
The diameter of a sphere is 18 in. Find the largest volume of regular pyramid of altitude 15 in. that can be cut from the sphere if the pyramid is (a) square, (b) pentagonal, (c) hexagonal, and (d)...
-
In a process for the manufacture of acetone, acetone is separated from acetic acid by distillation. The feed to the column is 60 mol per cent acetone, the balance acetic acid. The column is to...
-
Find the maximum shear stress in a 10-in circular saw if it runs idle at 7200 rev/min. The saw is 14 gauge (0.0747 in) and is used on a -in arbor. The thickness is uniform. What is the maximum...
-
The maximum recommended speed for a 300-mm-diameter abrasive grinding wheel is 2069 rev/min. Assume that the material is isotropic; use a bore of 25 mm, = 0.24, and a mass density of 3320 kg/m3; and...
-
An abrasive cutoff wheel has a diameter of 6 in, is 1/16 in thick, and has a 1-in bore. It weighs 6 oz and is designed to run at 10 000 rev/min. If the material is isotropic and = 0.20, find the...
-
Exactly 24 months ago in 2019, centronics inc issued a 15 year bond. the bond was issued at par to yield 6%. it pays interest annually. over the last 12 months, yields on bonds of similar risk have...
-
How COVID-19 news evoked sentiments and emotions. What are the financial implications of these sentiments for investors/policy makers?
-
How does the network of global stock markets reacts to covid-19? What countries (stock markets) plays most important role during covid-19? Explain.
Study smarter with the SolutionInn App