Question: Does inbreeding affect allele frequencies? Why or why not? How does it affect genotype frequencies? With regard to rare recessive diseases, what are the consequences

Does inbreeding affect allele frequencies? Why or why not? How does it affect genotype frequencies? With regard to rare recessive diseases, what are the consequences of inbreeding in human populations?

Step by Step Solution

★★★★★

3.53 Rating (163 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

In the absence of other forces inbreeding does not alter allele frequenci... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

894-M-S-B-G (673).docx

120 KBs Word File

Students Have Also Explored These Related Biology Questions!

Describe what happens to allele frequencies as a result of the bottleneck effect. Discuss the relevance of this effect with regard to species that are approaching extinction.

Let's suppose the mutation rate for converting a B allele into a b allele is 10-4. The current allele frequencies are B = 0.6 and b = 0.4. How long will it take for the allele frequencies to equal...

In a donor population, the allele frequencies for the common (HbA) and sickle cell (Hbs) alleles are 0.9 and 0.1, respectively. A group of 550 individuals migrates to a new population containing...

Lecture 1 . 2 0 0 Years of Darwin: A Theory's Origins 1 . The two major theories in The Origin of Species 2 . The distinction between the Lamarckism and Darwinism 3 . Why modern evolutionary biology...

GENETICS AND FORCES OF EVOLUTION Introduction The goal of anthropological genetics is to understand the evolutionary relationships, demographic histories, and genetic bases of biological variation in...

Inbreeding changes allele frequencies but not genotype frequencies in a population. Question 13 options: True False

Inbreeding changes allele frequencies but not genotype frequencies in a population

choose your answer... consists of short - term phenotypic changes that don't pass along to offspring. Features like Question Blank 2 of 2 , however, pass down to offspring and thus affect allele...

Both random and non - random processes can lead to evolution. alleles that represent adaptations. can randomly affect allele frequencies, while q , favors q ,

features like tanning in high uv enviornments . Features like Question Blank 2 of 2 , however, pass down to offspring and thus affect allele frequencies of future populations.

The density and specific heat of a plastic material are known (p = 950 kg/m 3 , c p = 1100 J/kg K), but its thermal conductivity is unknown. To determine the thermal conductivity, an experiment is...

Asset turnover is a measure of effectiveness. How can a firm increase its effectiveness?

12. Bond Interest Rates. Corporate triple-A bond interest rates for 12 consecutive months follow. 9.5 9.3 9.4 9.6 9.8 9.7 9.8 10.5 9.9 9.7 9.6 9.6 a. Construct a time series plot. What type of...

Assuming a fi xed aggregate demand curve, a leftward shift in the aggregate supply curve causes a (an) a. increase in the price level and a decrease in real GDP. b. increase in the price level and an...

Some vectors used in cloning experiments contain bacterial promoters that are adjacent to unique cloning sites. This makes it possible to insert a gene sequence next to the bacterial promoter and...

Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the techniques of dideoxy DNA sequencing or...

The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...

please answer the question in detail. thanks 1. Mr. X puts money in two investment opportunities. The first investment brings VND 1 million at the end of each year in 5 years. The second opportunity...

Town Crier has 10.0 million shares of common stock outstanding, 2.0 million shares of preferred stock outstanding, and 10.00 thousand bonds. If the common shares are selling for $28.00 per share, the...

Debt: Five thousand bonds with a face value of $1000 and an initial 20-year term were issued five years ago with a coupon rate of 8%. Coupon interests are paid semi-annually. Today these bonds are...