Explain why a file system that supports indexed sequential files cannot be expected to have the same

Question:

Explain why a file system that supports indexed sequential files cannot be expected to have the same performance level as pure sequentially accessed files.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Operating Systems

ISBN: 978-0201773446

3rd edition

Authors: Gary Nutt

See More Books

Question Posted: Jun 23, 2011 07:11 AM

See More Questions

The Delta Chemical Corporation is expected to have the capital structure for the foreseeable future as given in Table P15.10. The flotation costs are already included in each cost component. The...
How is the file system that supports IIS structured?
Which of the following molecules would be expected to have a dipole moment of zero because of symmetry? a. SeF2 b. BeI2 c. TeF6 d. TeF4
Rewrite these sentences to eliminate buzzwords and figures of speech. A. Also, through SCMC and by also gaining a membership in ISM, certification opportunities will be at your fingertips. B. The...
Instead, the researchers reweigh the 300-pound individual and record a new weight of 350 pounds. Will the mean increase or decrease in this situation? A group of researchers measures the weight of...
Extreme temperature changes result in many failures of electronic circuits [1]. Temperature control feedback systems reduce the change of temperature by using a heater to overcome outdoor low...
In order to be able to use industry benchmarks to evaluate a firms performance, it is necessary to determine the industry to which the firm belongs. Eurostat (European Statistical Office) is a...
Jessica Boland works for Sea Biscuit Co. She and Farah Smith, her manager, are preparing adjusting entries for annual financial statements. Boland computes depreciation and records it as Depreciation...
4. 5. In which of following conditions a real gas would behave ideally? (a) Low pressure and low temperature ha (b) At value of temperature equal to its Boyle's temperature (c) Between its critical...
Suppose, you are a CEO of a company and you just made a big investment in a new production facility. Your Chief Risk Officer provides you with the following information: Your liabilities consist of...
How many device operations are required to add a released node to a free list when the block status map approach is used to implement the free list?
Suppose a file system is based on the index allocation strategy for managing blocks. Assume each file has a directory entry giving the filename, first index block, and the length of the file. The...
A manufacturer of lightbulbs wants to produce bulbs that last about 700 hours but, of course, some bulbs burn out faster than others. Let F (t) be the fraction of the companys bulbs that burn out...
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
There are two sides to a marketa buying or demand side and a selling or supply side. Since most of us buy many more goods and services than we sell, lets consider the price a buyer pays for a good or...
The economist hears someone say: Business firms are all about maximizing revenue. If a firm is currently earning $$10$ million in total revenue, and it can sell 10 more units of whatever it is that...
The prices for ABC Companys stock over a 12-day period follow. Test, at the = .05 level, whether changes in the stock price are random. 83.20 81.15 79.32 80.10 79.21 78.30 79.65 80.27 89.82 90.10...
Global.asax is used for: a. declare application variables O b. all other answers are wrong O c. declare global variables O d. handle application events
Create an SQL query that calculates how many different therapies have not yet been booked for a session.
Cinderella and the Prince are getting divorced. To divide their property, they have agreed on the following algorithm. Every morning, each one may send a letter to the other's lawyer requesting one...
Cinderella and the Prince are getting divorced. To divide their property, they have agreed on the following algorithm. Every morning, each one may send a letter to the other's lawyer requesting one...
The four conditions (mutual exclusion, hold and wait, no preemption and circular wait) are necessary for a resource deadlock to occur. Give an example to show that these conditions are not sufficient...
Which line of the following author reading segment would causes issues? 1: bookArr[i].authors = calloc(bookArr[i].numAuthors, sizeof(author_t)); 2: for (j=0; j < bookArr[i].numAuthors; j++) { 3: 4:...
3. (20 points) Consider three periodic tasks A, B and C with their respective periods as 4ms, 6ms and 8ms. The execution time required for each task is 1 ms. (a) Draw a figure/table to execute these...
Write a method (pseudocode) to reverse the queue using another empty queue. You may only use queue operations such as enqueue(), dequeue(), and size(). No other data structure can be used other than...

Explain why a file system that supports indexed sequential files cannot be expected to have the same

Question:

Step by Step Answer:

A file organized as a pure sequential file has the properties of a magnetic tape ie after read...View the full answer

Operating Systems

Students also viewed these Computer Engineering questions