Explain why DNA sequences are evolutionary chronometers.
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 55% (9 reviews)
They provide a relative measure of the time elapsed since ...View the full answer
Answered By
Elias Gichuru
am devoted to my work and dedicated in helping my clients accomplish their goals and objectives,providing the best for all tasks assigned to me as a freelancer,providing high quality work that yields high scores.promise to serve them earnestly and help them achieve their goals.i have the needed expertise,knowledge and experience to handle their tasks.
4.80+
325+ Reviews
859+ Question Solved
Related Book For
Microbiology A Human Perspective
ISBN: 978-0073375311
7th edition
Authors: Eugene Nester, Denise Anderson, Evans Roberts
Question Posted:
Students also viewed these Biology questions
-
The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU,UUC Asp: GAU, GAC These sequences are complementary to the sequences...
-
In the pairs of DNA sequences below, the lower duplex represents a mutagenized daughter duplex. Identify the mutation as a transition, a transversion, an insertion, or a deletion. (a) (b) 5'...
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
In Exercises 7-9, find the indicated measure. The area of a circle is 380 square inches. Find the radius.
-
Independent auditors of financial statements perform audits that reduce a. Business risks faced by investors. b. Information risk faced by investors. c. Complexity of financial statements. d....
-
In Exercises evaluate the definite integral. Use a graphing utility to confirm your result. So In(4 + x) dx
-
A viscous fluid is contained between two infinitely long, vertical, concentric cylinders. The outer cylinder has a radius \(r_{o}\) and rotates with an angular velocity \(\omega\). The inner cylinder...
-
The adjusted trial balance of Pacific Scientific Corporation on December 31, 2011, the end of the company's fiscal year, contained the following income statement items ($ in millions): sales revenue,...
-
3) A bicycle tire pump has a piston with area 0.40 in 2 . If a person exerts a force of 15 lb on the piston while inflating a tire, what pressure does this produce on the air in the pump? 4) A large...
-
Horace and Lee CPAs (H&L) is a medium-sized CPA firm that performs review and audit engagements for mostly privately held companies. H&L also has a tax group. H&L is considering accepting...
-
When DNA probes are used to detect specific sequence similarities in bacterial DNA, the probe is heated and the two strands of DNA are separated. Why must the probe DNA be heated?
-
How would the curve appear if the AT content were increased?
-
Calculate the derivative indicated. d'y dt =1 y = 4t- +31
-
Sami, 34, and Ronald, 31, want to buy their first home. Their current combined net income is $65,000 and they have two auto loans totaling $32,000. They have saved approximately $12,000 for the...
-
The financial year of S. Smith ended on 31 December 2013. Show the ledger accounts for the following items including the balance transferred to the necessary part of the financial statements, also...
-
According to a January 5, 2017, article in The Guardian, consumer spending in Britain on subscription streaming services for movies and TV shows grew by \(23 \%\) between 2015 and 2016 to \( 1.3\)...
-
A \(1-\mathrm{kg}\) block is used to compress a spring with spring constant \(k=10.0 \mathrm{~N} / \mathrm{m}\) by \(5 \mathrm{~cm}\), and then released. Draw energy diagrams for the spring-mass...
-
An article in the Wall Street Journal reported that Tesla Inc. delivered about 35 percent more electric vehicles (EVs) in the first quarter of 2023 than in the same quarter of 2022. Elon Musk, Teslas...
-
In Exercises verify the particular solution of the differential equation. Solution y = e-cos.x Differential Equation and Initial Condition y' = y sin x (7) 2 y = 1
-
Huntingdon Capital Corp. is a competitor of Plazacorp and First Capital Realty. Huntingdon reported the following selected information (in millions):...
-
Why can one not reliably predict the sequence of nucleotides on mRNA or DNA by observing the amino acid sequence of proteins?
-
Explain the various mechanisms by which RNA can control transcription, translation, and gene expression.
-
Explain how epigenetics is related to the expression: phenotype = genotype + environment.
-
Can we justify the acquisition of Peloton Interactive Inc using NPV assuming the initial investment is 10% of the total market value of the company, 5% constant growth rate for the next three years...
-
Rivan Co. is considering a new three-year expansion project that requires an initial fixed asset investment of $2.18 million in a large building. The fixed asset applies three year MACRS for tax...
-
Mary would like to save $10,000 at the end of 5 years for a future down payment on a car. How much should she deposit at the end of each month in a savings account that pays 1.2%/a, compounded...
Study smarter with the SolutionInn App