For Westerville Company actual sales are $1,200,000 and break-even sales are $900,000. Compute (a) The margin of
Question:
(a) The margin of safety in dollars
(b) The margin of safety ratio.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 33% (3 reviews)
a Margin of safety ...View the full answer
Answered By
Aysha Ali
my name is ayesha ali. i have done my matriculation in science topics with a+ . then i got admission in the field of computer science and technology in punjab college, lahore. i have passed my final examination of college with a+ also. after that, i got admission in the biggest university of pakistan which is university of the punjab. i am studying business and information technology in my university. i always stand first in my class. i am very brilliant client. my experts always appreciate my work. my projects are very popular in my university because i always complete my work with extreme devotion. i have a great knowledge about all major science topics. science topics always remain my favorite topics. i am also a home expert. i teach many clients at my home ranging from pre-school level to university level. my clients always show excellent result. i am expert in writing essays, reports, speeches, researches and all type of projects. i also have a vast knowledge about business, marketing, cost accounting and finance. i am also expert in making presentations on powerpoint and microsoft word. if you need any sort of help in any topic, please dont hesitate to consult with me. i will provide you the best work at a very reasonable price. i am quality oriented and i have 5 year experience in the following field.
matriculation in science topics; inter in computer science; bachelors in business and information technology
_embed src=http://www.clocklink.com/clocks/0018-orange.swf?timezone=usa_albany& width=200 height=200 wmode=transparent type=application/x-shockwave-flash_
4.40+
11+ Reviews
14+ Question Solved
Related Book For
Managerial Accounting Tools for business decision making
ISBN: 978-0470477144
5th edition
Authors: Jerry J. Weygandt, Paul D. Kimmel, Donald E. Kieso
Question Posted:
Students also viewed these Managerial Accounting questions
-
For Gore Company actual sales are $1,200,000 and break-even sales are $840,000. Compute (a) The margin of safety in dollars (b) The margin of safety ratio.
-
The margin of safety tells managers How much profit would drop if sales decreased. How much profit would have to increase to hit target sales. How much sales would have to increase to hit the target...
-
The margin of safety is: the excess of budgeted or actual sales over budgeted or actual variable expenses. the excess of budgeted or actual sales over budgeted or actual fixed expenses. the excess of...
-
Given the observed yields below, what is the 1-year forward rate, 4 years from now? [Hint: This is the 1-year return that will take you from the 4-year average annualized return (yield) to the 5-year...
-
Suppose that a firm in a perfectly competitive industry finds that at its current output rate, marginal revenue exceeds the minimum average total cost of producing any feasible rate of output...
-
The Heartland Distribution Company is a food warehouse and distributor that has a contract with a grocery store chain in several Midwest and Southeast cities. The company wants to construct new...
-
Calculate the median for each of the following sets of data: a. 3, 4, 6, 7, 10 b. 14, 16, 19, 21, 22, 27, 36 c. 6, 6, 9, 9, 9, 10, 13, 16, 16, 21, 24 d. 4, 2, 6, 3, 8, 3, 8 e. 27, 24, 35, 30, 41, 32,...
-
Discuss the accuracy of this statement: Formal strategic planning systems are irrelevant for firms competing in high- technology industries where the pace of change is so rapid that plans are...
-
In a dealer market, the ask price is the highest price the dealer offered to buy a security and the bid price is the lowest price the dealer offered to sell a security. The difference of the ask...
-
A parallel chord Howe truss is loaded as shown. Determine the force in members CE, DE, and DF. 2fi
-
For Deines Company, variable costs are 70% of sales, and fixed costs are $210,000. Management's net income goal is $60,000. Compute the required sales needed to achieve management's target net income...
-
Bruno Corporation sells three different models of mosquito "zapper." Model A12 sells for $50 and has variable costs of $40. Model B22 sells for $100 and has variable costs of $70. Model C124 sells...
-
For each of the following, indicate if the statement reflects an input component, output component, or storage component of the accounting information system for a bank. A. Online customer check...
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Homologous recombination refers to the exchange of DNA segments that are a. similar or identical in their DNA sequences. b. in close proximity to one another. c. broken due to ionizing radiation. d....
-
L ets suppose you have isolated chromatin from some bizarre eukaryote that has a DNA linker region that is usually 300350 bp in length. The nucleosome structure is the same as in other eukaryotes. If...
-
A collection of recombinant vectors that carry fragments of chromosomal DNA is called a. a genomic library. b. a cDNA library. c. a Northern blot. d. either a or b.
-
Calculate the flux of the vector field \(\mathbf{E}(x, y, z)=\langle 0,0, xangle\) through the part of the ellipsoid \[ 4 x^{2}+9 y^{2}+z^{2}=36 \] where \(z \geq 3, x \geq 0, y \geq 0\). Hint: Use...
-
An Atomic Energy Commission nuclear facility was established in Hanford, Washington, in 1943. Over the years, a significant amount of strontium 90 and cesium 137 leaked into the Columbia River. In a...
-
Pick the best choices in Problems 1134 by estimating. Do not measure. For metric measurements, do not attempt to convert to the U.S. system. The hardest part of the transition to the metric system is...
-
Presented below are three different lease transactions in which Ortiz Enterprises engaged in 2010.Assume that all lease transactions start on January 1, 2010. In no case does Ortiz receive title to...
-
On July 1, 2010, Wheeler Satellites issued $4,500,000 face value, 9%, 10-year bonds at $4,219,600.This price resulted in an effective-interest rate of 10% on the bonds. Wheeler uses the...
-
On July 1, 2010, Remington Chemical Company issued $4,000,000 face value, 10%,10-year bonds at $4,543,627.This price resulted in an 8% effective-interest rate on the bonds. Remington uses the...
-
From the following, prepare a balance sheet for Kim Co. Cleaners at the end of September 202X: Cash, $67,000; Equipment, $7,000; Accounts Payable, $13,000; B. Kim, Capital. Prepare the balance sheet....
-
Kubin Company's relevant range of production is 25,000 to 33,500 units. When it produces and sells 29,250 units, its average costs per unit are as follows: Average Cost per Unit $8.50 $ 5.50 Direct...
-
Dozier Company produced and sold 1,000 units during its first month of operations. It reported the following costs and expenses for the month: Direct materials Direct labor $ 83,000 $ 42,000 Variable...
Study smarter with the SolutionInn App