Give examples of industries that are affected by seasonality. Why would these businesses want to filter out
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 50% (10 reviews)
Nearly every industry has seasonality The seasonality must be f...View the full answer
Answered By
Amar Kumar Behera
I am an expert in science and technology. I provide dedicated guidance and help in understanding key concepts in various fields such as mechanical engineering, industrial engineering, electronics, computer science, physics and maths. I will help you clarify your doubts and explain ideas and concepts that are otherwise difficult to follow. I also provide proof reading services. I hold a number of degrees in engineering from top 10 universities of the US and Europe.
My experience spans 20 years in academia and industry. I have worked for top blue chip companies.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Management Leadership questions
-
Give examples of industries in which demand forecasting is dependent on the demand for other products.
-
Give examples of industries for which a service is the primary productive output.
-
What are two examples of industries that could benefit from IoM?
-
March is a month of variable weather in the Northeast. The chart below records the actual high and low temperatures for a selection of days in March from the weather report for Pittsburgh,...
-
On a Saturday afternoon, 147 customers are observed during check-out and the number paying by card, credit or debit, is recorded. Records from the store suggest that 43% of customers pay by card....
-
For the month of November, AC3220 Ltd. recorded $500,000 in sales, 40% of which were on account (terms N30), and 60% of which were cash sales. The company is required to charge 15% HST on all sales....
-
(a) Among 880 smart phones sold by a retailer, 72 required repairs under the warranty. Estimate the probability that a new phone, which has just been sold, will require repairs under the warranty....
-
What are the tangible and intangible benefits that Walgreens receives by being a leader in hiring employees with disabilities?
-
Schaeffer Shippers announced on May 1 that it will pay a dividend of $1.20 per share on June 15 to all holders of record as of May 31st. The firm's stock price closed today at $42 a share. Assume all...
-
Joe Schreiner, controller for On Time Clock Company Inc., recently prepared the company?s income statement and statement of changes in equity for 2020. Schreiner believes that the statements are a...
-
Explain, in your own words, the meaning of the correlation coefficient. Discuss the meaning of a negative value of the correlation coefficient.
-
What happens to the ability to forecast for periods farther into the future?
-
Summerville Company, which uses the high-low method to analyze cost behavior, has determined that machine hours best predict the company's total utilities cost. The company's cost and machine hour...
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Homologous recombination refers to the exchange of DNA segments that are a. similar or identical in their DNA sequences. b. in close proximity to one another. c. broken due to ionizing radiation. d....
-
L ets suppose you have isolated chromatin from some bizarre eukaryote that has a DNA linker region that is usually 300350 bp in length. The nucleosome structure is the same as in other eukaryotes. If...
-
A collection of recombinant vectors that carry fragments of chromosomal DNA is called a. a genomic library. b. a cDNA library. c. a Northern blot. d. either a or b.
-
Suppose the reaction A 2 + B 2 2 AB proceeds via a one-step mechanism involving a collision between one A 2 molecule and one B 2 molecule. Suppose also that this reaction is reversible, and that the...
-
The landing gear of an aircraft with: mass of 2000 kg the spring-mass-damper system Consider that the runway surface is y(t) = 0.2 cos 157.08t stiffness of the spring is 5 x 105 N/m. What is the...
-
From the following trial balance of I. Lamb, extracted after one years trading, prepare an income statement for the year ending 31 October 2023. A balance sheet is not required. Inventory at 31...
-
The Best Wheels Bicycle Company produces bicycles in different styles for boys and girls, in heights of 26 inches or 20 inches, and with 10 speeds, 3 speeds, or 1 speed. a. How many different kinds...
-
From the product structure diagram for item X shown at the top of the next column, determine how many of each lower-level items (B through I) are needed to fill an order for 50Xs. , E 4) F) 1) 1-2)
-
From the product structure diagram for item X shown at the top of the next column, determine how many of each lower-level items (B through I) are needed to fill an order for 50Xs. , E 4) F) 1) 1-2)
-
Describe the value chain analysis methods that a firm might utilize to identify strategies to enhance organizational capabilities.
-
Nurses are advocates for patients and must find a balance while delivering patient care. Discuss
-
The geriatric nurse cares for patients who are aging or suffering from conditions normally, Discuss?
Study smarter with the SolutionInn App