Polymer deterioration by swelling may be reduced by which of the following? (A) Increasing degree of cross-linking,
Question:
(A) Increasing degree of cross-linking, increasing molecular weight, and increasing degree of crystallinity
(B) Decreasing degree of cross-linking, decreasing molecular weight, and decreasing degree of crystallinity
(C) Increasing degree of cross-linking, increasing molecular weight, and decreasing degree of crystallinity
(D) Decreasing degree of cross-linking, increasing molecular weight, and increasing degree of crystallinity
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 85% (14 reviews)
A Increasing degree of crosslinking increasing molecu...View the full answer
Answered By
Mwangi Clement
I am a tried and tested custom essay writer with over five years of excellent essay writing. In my years as a custom essay writer, I have completed more than 2,000 custom essays in a diverse set of subjects. When you order essays from me, you are working with one of the best paper writers on the web. One of the most common questions I get from customers is: “can you write my essay?” Upon hearing that request, my goal is to provide the best essays and overall essay help available on the web. I have worked on papers in subjects such as Nursing and Healthcare, English Literature, Sociology, Philosophy, Psychology, Education, Religious Studies, Business, Biological Sciences, Communications and Media, Physical Sciences, Marketing and many others. In these fields, my specialties lie in crafting professional standard custom writings. These include, but are not limited to: research papers, coursework, assignments, term papers, capstone papers, reviews, summaries, critiques, proofreading and editing, and any other college essays.
My extensive custom writings experience has equipped me with a set of skills, research abilities and a broad knowledge base that allows me to navigate diverse paper requirements while keeping my promise of quality. Furthermore, I have also garnered excellent mastery of paper formatting, grammar, and other relevant elements. When a customer asks me to write their essay, I will do my best to provide the best essay writing service possible. I have satisfactorily offered my essay writing services for High School, Diploma, Bachelors, Masters and Ph.D. clients.
I believe quality, affordability, flexibility, and punctuality are the principal reasons as to why I have risen among the best writers on this platform. I deliver 100% original papers that pass all plagiarism check tests (Turnitin, Copyscape, etc.). My rates for all papers are relatively affordable to ensure my clients get quality essay writing services at reasonable prices.
4.50+
5+ Reviews
14+ Question Solved
Related Book For
Materials Science and Engineering An Introduction
ISBN: 978-1118324578
9th edition
Authors: William D. Callister Jr., David G. Rethwisch
Question Posted:
Students also viewed these Modern Physics questions
-
Which of the following molecules may be polar 503' XeF4, 5F/
-
Which of the following molecular models correctly depicts the geometry of ClCN? CI C CI (a) (b)
-
Which of the following are molecular solids and which are covalent solids? Se8, HBr, Si, CO2, C, P4O6, SiH4?
-
In Exercises 7980, find the value of y if the line through the two given points is to have the indicated slope. (3, y) and (1, 4), m = -3
-
Estimate the effective radius of a glycine molecule in water at 25C given that its diffusion coefficient is 1.055 X 10-9 m2 S-1 and that the viscosity of water is 1.00 cP.
-
State the law of demand and explain how it relates to the principle of rational choice.
-
Draw a free-body diagram for the person in Exercise 8.4. Data from Exercises 8.4 Consider a person hanging motionless from a ring suspended from a cable, with the person's feet not touching the...
-
Fabulous Motor Company makes electric cars and has two products, the Simplegreen and the Fabulousgreen. To produce the Simplegreen, Fabulous Motor employed assets of $ 24,500,000 at the beginning of...
-
(a) The following information is given for 3 companies that are identical except for their capital structure: Orange Grape Apple Total invested capital 1,00,000 1,00,000 1,00,000 Debt/assets ratio...
-
Does drying barley seeds in a kiln increase the yield of barley? A famous experiment by William S. Gosset (who discovered the t distributions) investigated this question. Eleven pairs of adjacent...
-
Which of the following describes crevice corrosion? (A) Corrosion that occurs preferentially along grain boundaries (B) Corrosion that results from the combined action of an applied tensile stress...
-
(a) Compute the electrical conductivity of a cylindrical silicon specimen 7.0 mm (0.28 in.) diameter and 57 mm (2.25 in.) in length in which a current of 0.25 A passes in an axial direction. A...
-
Provide an example of a good externalitythat is, one that increases a projects true NPV over what it would be if just its own cash flows were considered.
-
A researcher identified a mutation in PR of phage that causes its transcription rate to be increased 10-fold. Do you think this mutation would favor the lytic or lysogenic cycle? Explain your answer.
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Suppose that player B rather than player A gets to move first in the sequential game described in this chapter. Draw the extensive form of the new game. What is the equilibrium for this game? Does...
-
A glass manufacturer produces hand mirrors. Each mirror is supposed to meet company standards for such things as glass thickness, ability to reflect, size of handle, quality of glass, color of...
-
(a) Briefly explain the difference between oxidation and reduction electrochemical reactions.
-
Demonstrate that the constant K in Equation 17.23 will have values of 534 and 87.6 for the CPR in units of mpy and mm/yr, respectively.
-
A piece of corroded steel plate was found in a submerged ocean vessel. It was estimated that the original area of the plate was 10 in.2 and that approximately 2.6 kg had corroded away during the...
-
Write a program that accepts a phone number of the form +1(xxx)-XXX-XXXX where x is a digit, and displays the sum of all digits in the phone number. Example (user's input in red, output in blue)...
-
4. (25 points) The reverse of a directed graph G is another directed graph GR with the same vertex set with the property that if (u, v) is an edge in G then (v, u) is an edge in GR. Consider the...
-
2. (25 points) The Fibonacci numbers Fo, F1,..., are defined by Fo 0, F11, Fn = Fn-1 + Fn-2 Use induction to prove that: (a) Use induction to prove that Fn 20.5n for n 6 (b) Use induction to prove...
Study smarter with the SolutionInn App