Question: Polypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro

Polypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?

Step by Step Solution

★★★★★

3.48 Rating (171 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

The initiation phase of translation is very different in bacteria and in eukaryotes so ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

894-M-S-B-G (946).docx

120 KBs Word File

Students Have Also Explored These Related Biology Questions!

Two eukaryotic genes encode two different polypeptides, each of which is 335 amino acids long. One gene contains a single exon; the other gene contains an intron of 41,324 nucleotide pairs long....

In prokaryotes, the error rate in protein synthesis may be as high as 5 10-4 per codon. What fraction of polypeptides containing (a) 500 residues or (b) 2000 residues would you expect to contain at...

Explain briefly what happens to eukaryotic mRNA before it can be translated to protein.

Q 3 . Polypeptides can be translated in vitro. Would bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why...

Polypeptides can be translated in vitro. Would bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Imagine that you are evaluating the early steps in translocation and processing of the secretory protein prolactin. By using an experimental approach similar to that shown in Figure 13-7, you can use...

Today, you will learn all about viruses by visiting various stations around the classroom while using a worksheet to guide you. For each question, go to the assigned website/read the article/watch...

6. Amino acids are the structural @# units monomers that make up proteins. They join together to form short polymers chains called peptides or longer chains called either polypeptides or proteins....

ow would these hormones be classified by their chemical origin? epinephrine [ Choose ] derived from cholesterol derived from polypeptides derived from amino acids derived from polypeptide bound to...

Race Car Inc. retails racing products for BMWs, Porsches, and Ferraris. The following accounts and their balances appear in the ledger of Race Car Inc. on April 30, the end of the current year:...

Presented below are three independent situations. Answer the question at the end of each situation. 1. During 2008, Salt-n-Pepa Inc. became involved in a tax dispute with the IRS. Salt-n-Pepas...

find f ' ( x ) for f ( x ) = 3 ^ 3 - x ^ 1 9 / 2

If Qd = quantity demanded and Qs = quantity supplied at a given price, a shortage in the market results when a. Qs is greater than Qd. b. Qs equals Qd. c. Qd is less than or equal to Qs. d. Qd is...

A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...

An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...

A tRNA has the anticodon sequence 3CAG5. What amino acid does it carry?

A convertible bond has a 6.5 percent coupon, paid semiannually, and will mature in 10 years. If the bond were not convertible, it would be priced to yield 5.5 percent. The conversion ratio on the...

Word Problem 20-24 [LU 20-3(1)] A local Dunkin' Donuts franchise must buy a new piece of equipment in 6 years that will cost $95,000. The company is setting up a sinking fund to finance the purchase....

An insurance company must make payments to a customer of $ 1 2 million in one year and $ 6 million in three years. The yield curve is flat at 8 % . a . If it wants to fully fund and immunize its...