Why is occurrence a high-risk assertion for revenue?
Question:
Why is occurrence a high-risk assertion for revenue?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 60% (5 reviews)
In general this is an assertion that has a high ris...View the full answer
Answered By
Ashington Waweru
I am a lecturer, research writer and also a qualified financial analyst and accountant. I am qualified and articulate in many disciplines including English, Accounting, Finance, Quantitative spreadsheet analysis, Economics, and Statistics. I am an expert with sixteen years of experience in online industry-related work. I have a master's in business administration and a bachelor’s degree in education, accounting, and economics options.
I am a writer and proofreading expert with sixteen years of experience in online writing, proofreading, and text editing. I have vast knowledge and experience in writing techniques and styles such as APA, ASA, MLA, Chicago, Turabian, IEEE, and many others.
I am also an online blogger and research writer with sixteen years of writing and proofreading articles and reports. I have written many scripts and articles for blogs, and I also specialize in search engine
I have sixteen years of experience in Excel data entry, Excel data analysis, R-studio quantitative analysis, SPSS quantitative analysis, research writing, and proofreading articles and reports. I will deliver the highest quality online and offline Excel, R, SPSS, and other spreadsheet solutions within your operational deadlines. I have also compiled many original Excel quantitative and text spreadsheets which solve client’s problems in my research writing career.
I have extensive enterprise resource planning accounting, financial modeling, financial reporting, and company analysis: customer relationship management, enterprise resource planning, financial accounting projects, and corporate finance.
I am articulate in psychology, engineering, nursing, counseling, project management, accounting, finance, quantitative spreadsheet analysis, statistical and economic analysis, among many other industry fields and academic disciplines. I work to solve problems and provide accurate and credible solutions and research reports in all industries in the global economy.
I have taught and conducted masters and Ph.D. thesis research for specialists in Quantitative finance, Financial Accounting, Actuarial science, Macroeconomics, Microeconomics, Risk Management, Managerial Economics, Engineering Economics, Financial economics, Taxation and many other disciplines including water engineering, psychology, e-commerce, mechanical engineering, leadership and many others.
I have developed many courses on online websites like Teachable and Thinkific. I also developed an accounting reporting automation software project for Utafiti sacco located at ILRI Uthiru Kenya when I was working there in year 2001.
I am a mature, self-motivated worker who delivers high-quality, on-time reports which solve client’s problems accurately.
I have written many academic and professional industry research papers and tutored many clients from college to university undergraduate, master's and Ph.D. students, and corporate professionals. I anticipate your hiring me.
I know I will deliver the highest quality work you will find anywhere to award me your project work. Please note that I am looking for a long-term work relationship with you. I look forward to you delivering the best service to you.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Auditing The Art and Science of Assurance Engagements
ISBN: 978-0134613116
14th Canadian edition
Authors: Alvin A. Arens, Randal J. Elder, Mark S. Beasley, Joanne C. Jones
Question Posted:
Students also viewed these Business questions
-
Why is valuation a high-risk assertion for accounts receivable?
-
MULTIPLE-CHOICE QUESTIONS 1. Which of the following statements is true regarding assertions in the revenue cycle? a. It is typical that all five assertions for revenue are equally important. b. If a...
-
a. Analysis and evaluation: Evaluate the effectiveness of the CIRI?s control environment. You may evaluate each individual component of the control environment but then develop an overall conclusion...
-
An employee received the following benefits: regular compensation income, net of P25,000 SSS, PHIC & HDMF employee share - P850,000; 13th month pay - P120,000; De minimis benefits within their limits...
-
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
-
Using the data in MD-3, assume that Princeton Company purchased the voting stock of Cox Corporation for its portfolio of available-for-sale securities instead of its trading securities portfolio....
-
In the 1970s, Special Electric Company brokered the sale of crocidolite asbestos, which is the most toxic form of asbestos, to Johns- Manville Corporation. Special Electric never held possession of...
-
The computer output given below is for Problem 7-31. Use this to answer the following questions. (a) How much could the profit on X increase or decrease without changing the values of X and Y in the...
-
You ask your sister to look up the stock prices of two different companies: Carnival Cruise Lines (CCL) and, the world's largest toilet paper producer, Procter & Gamble (PG). How have the stock...
-
Define a project. What are five characteristics that help differentiate projects from other functions carried out in the daily operations of the organization?
-
Jeff Jacobs is a junior accountant with the public accounting firm of Maxwell and King LLP. Jeff was assigned to do the audit of Astor Electronics Inc. The in-charge auditor informed Jeff that, based...
-
Why is accounts receivable often an important account to audit?
-
Sun City Greenhouse had trouble collecting its account receivable from Sharma Suiza. On June 19, 2025, Sun City Greenhouse finally wrote off Suizas $700 account receivable. On December 31, Suiza sent...
-
In these scenarios, you are a community correctional administrator tasked with making policy changes, changes in the way things are done and, if need be, personnel adjustments. You also have control...
-
Explore the design principles underlying modern file systems, considering factors such as data organization, metadata management, and techniques for optimizing file access performance in diverse...
-
Folly Beach Surf Shop purchases surfboards for $250 per board. Folly Beach's standard markup on surfboards is 30%. Using the cost-plus pricing method, what price should Folly Beach charge for a...
-
Leah Horowitz's credit card uses the average-daily-balance method-new purchases included. Her finance charge this past billing cycle was $25.95, and her average daily balance was $998.08. Find her...
-
What legislations enhanced the Interstate Commerce Commission's ability to inspect any railroad company's financial records.
-
Selected account balances at December 31, 2014, for Infosys Company follow. Prepare a multistep income statement for the year ended December 31, 2014. Show detail of net sales. The company uses the...
-
A business had revenues of $280,000 and operating expenses of $315,000. Did the business (a) Incur a net loss (b) Realize net income?
-
Explain why existence is a relevant assertion for fixed assets. How does identifying relevant assertions affect audit objectives and evidence accumulation?
-
Identify the management assertion and presentation and disclosure-related audit objective for the specific presentation and disclosure-related audit objective: Read the fixed asset footnote...
-
Identify the eight phases of the audit. What is the relationship of the eight phases to the objective of the audit of financial statements?
-
Mzee have Tshs 800,000,000 in the bank account, of which he wants to invest in Physical assets, Marketable investment and financial investments. As an expert in investment collect necessary...
-
find intervals of convergence of f(x), f'(x), f''(x) and the antiderivative of f(x). check for endpoints . f(x) = = n=1 (1)"+(x 2)" n
-
What force ( in N ) must be applied to a 1 5 0 . 0 kg crate on a frictionless plane inclined at 3 0 degree to cause an acceleration of 6 . 5 m / s 2 up the plane?
Study smarter with the SolutionInn App