Carbon dioxide, CO 2 , was shown to effuse through a porous plate at the rate of
Question:
Carbon dioxide, CO2, was shown to effuse through a porous plate at the rate of 0.033 mol/min. The same quantity of an unknown gas, 0.033 moles, is found to effuse through the same porous barrier in 104 seconds. Calculate the molar mass of the unknown gas.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 66% (3 reviews)
To calculate the molar mass of the unknown gas you can use Grahams law of effusion Grahams law state...View the full answer
Answered By
ANDREW KIPRUTO
Academic Writing Expert
I have over 7 years of research and application experience. I am trained and licensed to provide expertise in IT information, computer sciences related topics and other units like chemistry, Business, law, biology, biochemistry, and genetics. I'm a network and IT admin with +8 years of experience in all kind of environments.
I can help you in the following areas:
Networking
- Ethernet, Wireless Airmax and 802.11, fiber networks on GPON/GEPON and WDM
- Protocols and IP Services: VLANs, LACP, ACLs, VPNs, OSPF, BGP, RADIUS, PPPoE, DNS, Proxies, SNMP
- Vendors: MikroTik, Ubiquiti, Cisco, Juniper, HP, Dell, DrayTek, SMC, Zyxel, Furukawa Electric, and many more
- Monitoring Systems: PRTG, Zabbix, Whatsup Gold, TheDude, RRDtoo
Always available for new projects! Contact me for any inquiries
4.30+
1+ Reviews
10+ Question Solved
Related Book For
Chemistry And Chemical Reactivity
ISBN: 9780357001172
10th Edition
Authors: John C. Kotz, Paul M. Treichel, John Townsend, David Treichel
Question Posted:
Students also viewed these Sciences questions
-
A gas evolved from the fermentation of glucose is found to effuse through a porous barrier in 15.0 min. Under the same conditions of temperature and pressure, it takes an equal volume of N2 12.0 min...
-
A gas of unknown molecular mass was allowed to effuse through a small opening under constant-pressure conditions. It required 105 s for 1.0 L of the gas to effuse. Under identical experimental...
-
In an experiment, you have determined that 0.66 moles of CF 4 effuse through a porous barrier over a 4.8minute period. How long will it take for 0.66 moles of CH 4 to effuse through the same barrier?
-
50 successes in 200 trials when p = 0.2. For the binomial experiments find the normal approximation for the probability of
-
Which types of retail outlets are best suited to intensive distribution? To selective distribution? To exclusive distribution? Explain your answer in each case.
-
The following data structure and constraints exist for a magazine publishing company. a. The company publishes one regional magazine each in Florida (FL), South Carolina (SC), Georgia (GA), and...
-
Air flows from a pipe into the region between two parallel circular disks as shown in Fig. P4.51. The fluid velocity in the gap between the disks is closely approximated by \(V=V_{0} R / r\), where...
-
JJS Corporation purchased a building on January 1, 2007, for a total of $12,000,000. The building has been depreciated using the straight-line method with a 20-year useful life and no residual value....
-
What do you think is important to employees to make them stay and continue with a company through all the growth and changes that can happen?
-
A balloon is filled with helium gas to a gauge pressure of 22 mm Hg at 25C. The volume of the gas is 305 mL, and the barometric pressure is 755 mm Hg. What amount of helium is in the balloon?
-
The ideal gas law is least accurate under conditions of high pressure and low temperature. In those situations, using the van der Waals equation is advisable. (a) Calculate the pressure exerted by...
-
Select For Our Investors near the bottom of the page. Then, select Best Buys most recent annual report in the PDF format. Use the consolidated balance sheets to answer the following questions. At the...
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Beard Manufacturing is extremely security conscious, especially in the area of its information system. Because of this, the director of the computer center has installed a sophisticated computer...
-
Which of the following gives the range of y = 4 - 2 -x ? (A) (- , ) (B) (- , 4) (C) [- 4, ) (D) (- , 4] (E) All reals
-
Draw the influence line for the moment at Fin the girder. Determine the maximum positive live moment in the girder at F if a single concentrated live force of 8 kN moves across the top floor beams....
-
A uniform live load of 4 k/ft and a single concentrated live force of 20 k are placed on the floor beams. If the beams also support a uniform dead load of 700 lb/ft, determine (a) The maximum...
-
A uniform live load of 0.2 k/ft and a single concentrated live force of 4 k are placed on the floor beams. Determine (a) The maximum positive shear in panel DE of the girder, and (b) The maximum...
-
10.) How many iterations will the following loop execute? int intIndex = 100; while (int Index < 10) Console.WriteLine ("hello"); int Index += 1;
-
5. [10 points] Consider the following graph: 2 5 3 6 a) Starting at vertex 1 and resolving ties by vertex d number, traverse the graph by depth- first search and construct the corresponding...
-
How many processes are created by the following program, including the initial process. (.5 Marks) #include #include int main() { int i; for (i=0; i <5; i++) fork(); return 0; ANSWER:
Study smarter with the SolutionInn App