______ carries coded instructions for an amino acid sequence to the ribosome. a.DNA b. RRNA c. MRNA
Question:
______ carries coded instructions for an amino acid sequence to the ribosome.
a. DNA
b. RRNA
c. MRNA
d. TRNA
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (1 review)
Answered By
Ajeet Singh
Hi there! Are you looking for a committed, reliable, and enthusiastic tutor? Well, teaching and learning are more of a second nature to me, having been raised by parents who are both teachers. I have done plenty of studying and lots of learning on many exciting and challenging topics. All these experiences have influenced my decision to take on the teaching role in various capacities. As a tutor, I am looking forward to getting to understand your needs and helping you achieve your academic goals. I'm highly flexible and contactable. I am available to work on short notice since I only prefer to work with very small and select groups of students. Areas of interest: Business, accounting, Project management, sociology, technology, computers, English, linguistics, media, philosophy, political science, statistics, data science, Excel, psychology, art, history, health education, gender studies, cultural studies, ethics, religion. I am also decent with math(s) & Programming. If you have a project you think I can take on, please feel welcome to invite me, and I'm going to check it out!
5.00+
4+ Reviews
24+ Question Solved
Related Book For
Question Posted:
Students also viewed these Sciences questions
-
Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
-
To study the function of a gene in detail, you downloaded a piece of genomic sequence for this gene from the NCBI database. 5 - ATGAACACTTCGGAAGGTTGTATCGGTGGTCGATTC - 3 a. (10 pts) Write down the...
-
Consider the following two peptides, which may have been isolated from the floor of a Big Ten basketball arena circa 2000: A: K-E-A-D-Y B: K-N-I-G-H-T (a) Which peptide is more basic (has the higher...
-
A 30-year maturity bond making annual coupon payments with a coupon rate of 12% has duration of 11.54 years and convexity of 192.4. The bond currently sells at a yield to maturity of 8%. Use a...
-
Fabulator, Inc. produces and sells fashion clothing. On July 1, 2012, Fabulator, Inc. issued $120,000,000 of 20-year, 14% bonds at a market (effective) interest rate of 11%, receiving cash of...
-
Determine the minimum initial velocity v 0 and the corresponding angle 0 at which the ball must be kicked in order for it to just cross over the 3-m-high fence. 6 m 3 m
-
Shirley Jones, a well-known actress and California resident, brought a lawsuit in California court against the president of the National Enquirer newspaper and one of its reporters. The National...
-
During 2014, Cupello Corporation had a net income of $144,000. Included on its income statement were depreciation expense of $16,000 and amortization expense of $1,800. During the year, Accounts...
-
The atomic number of element M, N, R, and T are 1, 8, 12 and 14 respectively. The element which can form ions by either losing or gaining electron(s) is M 11. A. B. N C R D. T 12. The atomic number...
-
Name the three classes of RNA and describe their functions.
-
How does RNA differ from DNA?
-
(a) A unit of time sometimes used in microscopic physics is the shake. One shake equals 10-8 s. Are there more shakes in a second than there are seconds in a year? (b) Humans have existed for about...
-
Question The closing inventory at 5 April 2023 is valued at 4,974. On 5 December 2022, Gloria sold a motor vehicle for 4,820. The customer was due to pay Gloria on 5 April 2023 but only paid half of...
-
The financial manager Katrina Sdn Bhd, a manufacturing firm, has decided to seek a line of credit from the Alliance Bank. This additional source of funds is needed to support a large portion of the...
-
Use Ito's lemma to show that (a) sdW(s) =tW (t) - W(s)ds (b) W(s)dW(s) = W (t) fW(s)ds (c) E(W(t)) = 31, -
-
DANELLA DANCE studios is evaluating the purchase of new sound equipment that will increase the probability of your aerobic dances. The equipment will cost $28,000. Danells is not sure how many...
-
A bank pays a floating rate of interest on deposits (i.e. liabilities) and earns a fixed rate of interest on loans (i.e. assets). This mismatch between assets and liabilities can cause tremendous...
-
Your company has purchased a new track hoe for $100,000. The track hoe can be billed out at $95.00 per hour, has an hourly operation cost of $33.00, and has a useful life of four years. At the end of...
-
The water in tank A is at 270 F with quality of 10% and mass 1 lbm. It is connected to a piston/cylinder holding constant pressure of 40 psia initially with 1 lbm water at 700 F. The valve is opened,...
-
Suggest an efficient synthesis for the following transformation: CI H
-
A student gets up from her chair and pushes a stack of books across the table. They fall to the floor. Is the work associated with each part of this process positive, negative, or zero?
-
Why is H sublimation = H fusion + H vaporization ?
-
In 2024, the Westgate Construction Company entered into a contract to construct a road for Santa Clara County for $10,000,000. The road was completed in 2026. Information related to the contract is...
-
Todrick Company is a merchandiser that reported the following information based on 1,000 units sold: Sales Beginning merchandise inventory. Purchases Ending merchandise inventory Fixed selling...
-
ABC Inc. uses normal costing for its job costing system, which has two direct-cost categories (direct materials and direct manufacturing labor) and one indirect-cost category (manufacturing...
Study smarter with the SolutionInn App