Which of the following writes the contents of the city and state variables to an output file

Question:

Which of the following writes the contents of the city and state variables to an output file named address.txt? The file is associated with the outFile object.

a. address.txt << city << state << endl;

b. ofstream << city << state << endl;

c. outFile >> city >> state >> endl;

d. outFile << city << '#' << state << endl;

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Microsoft Visual C# An Introduction to Object-Oriented Programming

ISBN: 978-1337102100

7th edition

Authors: Joyce Farrell

See More Books

Question Posted: Aug 27, 2020 09:25 AM

See More Questions

Which of the following writes the contents of the city variable to an output file named address.txt? The file is associated with the outFile object. a. address.txt < < city < < endl; b. ofstream < <...
Which of the following reads a number from an input file named managers.txt and stores the number in the salary variable? The file is associated with the inFile object. a. managers.dat < < salary; b....
Which of the following opens the payroll.txt file for output? The file is associated with the outPayroll object. a. outPayroll.open("payroll.txt"); b. outPayroll.open("payroll.txt", ios::out); c....
Consider a dynamic array where the capacity doubles when additional space is needed and shrinks by 50% when the size falls below 1/4 capacity. What will be the amortized big-O of an append()...
Repeat Problem 61 with the cost and revenue equations y = 65,000 +1,100x Cost equation y = 1,600x Cost equation Problem 61 Repeat Problem 61 with the cost and revenue equations y = 65,000 + 1,100x...
A bank purchases $60,000 in bonds from a bond dealer who has a checking account at the bank. show how the bank's balance sheet be affected by this change. Only list the changes on your balance sheet....
What is the rate of return for a $\$ 14,000,20$-year investment that provides a payout of $\$ 1,000$ a year?
Good Luck Brands reported a carrying value of its total inventory as of December 31, 2013, of $2,047.6 million; the corresponding figure for December 31, 2012, was $1,937.8. Good Luck Brands applies...
Project AX910 has a time series of cash flows that changes sign repeatedly. Project AX910 has three different IRRs. They are at 15%, 25%, and 35%. What can we say about using the Internal Rate of...
For SO2 at 600 K and 300 bur. determine good estimates of the fugacity and of GR/RT.
Which function determines whether the open function was successful? a. is_open b. isopen c. isFileOpen d. is_FileOpen
Which of the following tells the computer to repeat the loop instructions until the end of the file is reached? The file is associated with the inFile object. a. while (inFile.eof()) b. while...
You plan to contribute $300 per month to your companys retirement plan and want to know how much you will have at retirement. Indicate whether you would solve for the future value of a single sum,...
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
adidas Group reports the following balance sheet accounts for the year ended December 31, 2014 (euros in millions). Prepare the balance sheet for this company as of December 31, 2014, following usual...
Fahrad Inc. sells all of its product on account. Fahrad has the following accounts receivable payment experience: Percent paid in the month of sale .........10 Percent paid in the month after the...
Create the logic for a program that prompts the user for numeric values for a month, day, and year. Then pass the three variables to the following methods: a. A method that displays the date with...
Create the logic for a program that computes hotel guest rates at Cornwalls Country Inn. Include two overloaded methods named computeRate(). One version accepts a number of days and calculates the...
Create the logic for a program that prompts a user for 12 numbers and stores them in an array. Pass the array to a method that reverses the order of the numbers. Display the reversed numbers in the...
Apply Euler's method by hand with N = 4 to find yo, Y1, Y2, Y3, Y4 on [0,1] where Y' y' = - 2y + 3t y(0) =1 Note: Please don't use Python for this. You are allowed to use a calculator do the...
What amount paid on September 6 is equivalent to $ 2 , 6 0 0 paid on the following December 1 if money can earn 6 . 6 % ? ( Use 3 6 5 days a year. Do not round intermediate calculations and round...
For R1= 6.8k, and R2= 1k, Then: V(1) = v V. 1(2) = mA.

Which of the following writes the contents of the city and state variables to an output file

Question:

Step by Step Answer:

d outF...View the full answer

Microsoft Visual C# An Introduction to Object-Oriented Programming

Students also viewed these Computer science questions