Question: ( 1 0 p ) Apply the Horspool's algorithm to search for the given pattern ( gene segment ) in the given DNA sequence. Construct

(10p) Apply the Horspool's algorithm to search for the given pattern (gene segment) in the given DNA sequence. Construct the shift table and illustrate and count comparisons as described in class.
DNA sequence = TAGCTCTTTTAAAAGTGTCCGATTCCA
Gene segment = ATTCCA
Shift table
\table[[A,C,G,T],[,,,]]
Total number of comparisons =
\table[[T,A,G,C,T,C,T,T,T,T,A,A,A,A,G,T,G,T,C,C,G,A,T,T,C,C,A],[,,,,,,,,,,,,,,,,,,t,,,,,,,,],[,,9,,,,IF,,,,,,,,,,,,,,,,,,,,],[,,',,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,e1,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,4,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,c,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,2,,,,,,,,,],[,,,,6,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,8,,,,,,,,,,,,7,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,4,,,,,,,,,],[,,,,,,,,,,,,,,85,,,,,,,,,,,,],[,,,,,,,,,*,,,,,10,,,,,,,,,,,,],[,,,,,,,,,,,*,,,,,,8,,,,,,,,,],[,,,,,,,,5,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,s,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,],[,,,,,,,,,,,,,,,,,,,,,,,,,,]]
( 1 0 p ) Apply the Horspool's algorithm to

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Accounting Questions!