Question: 1. (2 points) An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'. Given a DNA string corresponding to

1. (2 points) An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'. Given a DNA string corresponding to a coding strand, its transcribed RNA string u is formed by replacing all occurrences of 'T' in t with 'U' in u. Given: A DNA string having length at most 1000 nt. Return: The transcribed RNA string Sample input: GATGGAACTTGACTACGTAAATT Sample output: GAUGGAACUUGACUACGUAAAUU Please write a program for it

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

USING ONLY SYS and MATH MODULES please INI2: Given: Two positive integers a and b, each less than 1000. Return: The integer corresponding to the length of the hypotenuse of the right triangle whose...

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

A creative engineer suggests structuring the TLB so that not all the bits of the presented address need match to result in a hit. Suggest how this might be achieved, and what might be the costs and...

Portray in words what transforms you would have to make to your execution to some degree (a) to accomplish this and remark on the benefits and detriments of this thought.You are approached to compose...

both in java please........ 1. n this exercise, you will be counting the number of letters, digits, whitespaces and special characters in a user specified file. Any character that is not a letter, a...

Problem 2 (25 points): Open reading frame finder. An Opending Reading Frame (ORF) is a continuous stretch of codons (nu- cleotide triplets) that contain a start codon (i.e., ATG) at the beginning and...

HASKEL ASSIGNMENT -- * Each part has a main function for testing that part. -- * Make additional helper functions wherever you need them. -- * Replace 'undefined' with your own code when you are...

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

Prolog You are approached to compose a Prolog program to work with twofold trees. Your code shouldn't depend on any library predicates and you ought to expect that the mediator is running without...

Suppose that R(A, B, C) is a relational schema with functional dependencies F = {A, B C, C B}. (i) Is this schema in 3NF? Explain. [2 marks] (ii) Is this schema in BCNF? Explain. [2 marks] (b)...

A straight tunnel is dug through the earth as shown in Figure. Assume that the walls of the tunnel are frictionless. (a) The gravitational force exerted by the earth on a particle of mass m at a...

Susan had an auto loan left of $11,000 with a 14.6% interest rate. Her payment is $400 a month, $200 a month goes to the principle of the vehicle (loan) and $200 in interest. How much would Susan...

3.24 Find the probability distribution for the number of comic books when 4 books are selected at random from a collection consisting of 5 comic books, 2 art books, and 3 math books. Express your...

what would be the age bracket for marketing Dollar General

3-9 Despite aggressive campaigns to attract customers with lower mobile phone prices, T-Mobile has been losing large numbers of its most lucrative two-year contract subscribers. Management wants to...

3-4 What are the challenges posed by strategic information systems and how should they be addressed? List and describe the management challenges posed by strategic information systems. Explain how...

3-5 It has been said that there is no such thing as a sustainable strategic advantage. Do you agree? Why or why not?