Question: 4. Part of the MRNA sequence of an exon of a gene that encodes a bood protein is: AUGACUCAUCGCUGUAGUUUACGA Consult the genetic code to

4. Part of the MRNA sequence of an exon of a gene

4. Part of the MRNA sequence of an exon of a gene that encodes a bood protein is: AUGACUCAUCGCUGUAGUUUACGA Consult the genetic code to answer the following questions: a. What is the sequence of amino acids that this MRNA encodes? b. What is the sequence if a point mutation changes the tenth base from a C to an A? c. What is the effect of a point mutation that changes the fifteenth base from a U to an A? d. How does the encoded amino acid sequence change if a C is inserted between the fourth and fifth bases? e. Which would be more devastating to the encoded amino acid sequence, insertion of three bases in a row, or insertion of two bases in a row?

Step by Step Solution

★★★★★

3.40 Rating (156 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

To answer the following questions use the financial statements for Home Depot, Inc., in Appendix A at the end of the textbook: a. Compute the companys current ratio and quick ratio for the most...

Answer the following questions 1. What essay was about waitressing at a fast food place? 2. Why did Eighner prefer the dumpster near a college dorm around Dads day? 3. What was Eighners number one...

Answer the following Questions a. What was the Acceptable Use Policy in place on the Internet before 1995? b. Why did commercial activities on the Internet become acceptable in 1995? c. What are the...

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txtand ecoli.txtfrom below. Save these files in the same folder...

In Java please. 3 CLASS STUDENT An object of this class will represent a single student. 3.1 fields int id : A unique id number . String name : A non unique name. It can be first last or just first...

""" Code file for M269 20J TMA01 Question 3. Student version 4: 24/03/20 """ """ The following table determines which amino acid is produced by a particular 3-base DNA codon. It uses a Python...

Help me answer this worksheet Per. Biology: Protein Synthesis Review Worksheet Name Identify each definition with key terms from this unit. amino acid c-site protein rRNA frameshift mutation * exon...

RT 4 -Paragraph Comprehension Roosevelt Made Conscious Use Of The Media Almost From The Moment He Entered The White House. His Press Conferences Served To Educate Newspaper Writers, And Through Them...

The Statement: 'The merits of administrative action, to the extent that they can be distinguished from legality, are for the repository of the relevant power and, subject to political control, for...

Report on the engagement activities that have occurred with your group during the term and share your personal/individual plans to continue interactions beyond the course. Produce either a text...

A short, cantilevered round peg is 40 mm in diameter and extends 10 mm from the wall. It is loaded, as shown, with a force F = 50 kN applied at the tip in the negative z direction, and a torque T=...

11. Todd fractured his wrist while he was Rollerblading. To relieve the pain, his doctor suggested that he take 500 mg of aspirin every 6 h. At this rate, only 26% of the aspirin remains in his body...

Solve the following problems using Mohr's circle. Given: P = 10.5 ksi + P Normal stresses: Ox'= Oy= 8 ksi Draw Mohr's circle and use it to determine the normal and shearing stresses after the element...

2. (6 points) Calculate the charge of a 4.0 g sample of Zinc (atomic number 30, atomic mass 65.37 g/mole, density 7.133g/cm) from which one electron out of every 101 electrons has been removed

JAVA PROJECT Java Applications Cumberland Training Services ( CTS ) has commissioned your firm to design and develop an application that can simulate their instruction policies, procedures and...

Clark, PA, has been engaged to perform the audit of Kent Ltd.s financial statements for the current year. Clark is about to commence auditing Kents employee pension expense. Her preliminary enquiries...

Guenther and Firmin, both of whom are CPAs, form a partnership, with Guenther investing $100,000 and Firmin, $80,000. They agree to share net income as follows: 1. Salary allowances of $80,000 to...

The accounting staff of Wyoming Outfitters, Inc., has assembled the following information for the year ended December 31, 2011: Cash and cash equivalents, Jan. 1 . . . . . . . . . . . . . . . . . . ....

The following computation of the materials variances of Weitzen Foods is incomplete. The missing data are labeled (a) through (d). Materials price variance = 3,640 pounds [(a) standard price - $9.00...

26. How do genes and hormones infl uence taste sensitivity?

28. What is the mean life span of an olfactory receptor?

27. How do olfactory receptors resemble metabotropic neurotransmitter receptors?