4. Part of the MRNA sequence of an exon of a gene that encodes a bood...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
4. Part of the MRNA sequence of an exon of a gene that encodes a błood protein is: AUGACUCAUCGCUGUAGUUUACGA Consult the genetic code to answer the following questions: a. What is the sequence of amino acids that this MRNA encodes? b. What is the sequence if a point mutation changes the tenth base from a C to an A? c. What is the effect of a point mutation that changes the fifteenth base from a U to an A? d. How does the encoded amino acid sequence change if a C is inserted between the fourth and fifth bases? e. Which would be more devastating to the encoded amino acid sequence, insertion of three bases in a row, or insertion of two bases in a row? 4. Part of the MRNA sequence of an exon of a gene that encodes a błood protein is: AUGACUCAUCGCUGUAGUUUACGA Consult the genetic code to answer the following questions: a. What is the sequence of amino acids that this MRNA encodes? b. What is the sequence if a point mutation changes the tenth base from a C to an A? c. What is the effect of a point mutation that changes the fifteenth base from a U to an A? d. How does the encoded amino acid sequence change if a C is inserted between the fourth and fifth bases? e. Which would be more devastating to the encoded amino acid sequence, insertion of three bases in a row, or insertion of two bases in a row?
Expert Answer:
Related Book For
Financial and Managerial Accounting the basis for business decisions
ISBN: 978-0078111044
16th edition
Authors: Jan Williams, Susan Haka, Mark Bettner, Joseph Carcello
Posted Date:
Students also viewed these biology questions
-
To answer the following questions use the financial statements for Home Depot, Inc., in Appendix A at the end of the textbook: a. Compute the companys current ratio and quick ratio for the most...
-
Answer the following questions 1. What essay was about waitressing at a fast food place? 2. Why did Eighner prefer the dumpster near a college dorm around Dads day? 3. What was Eighners number one...
-
Answer the following Questions a. What was the Acceptable Use Policy in place on the Internet before 1995? b. Why did commercial activities on the Internet become acceptable in 1995? c. What are the...
-
Ford Company's cost of capital is 13%. It has invested x (million dollars) in current assets. The following function represents the shortage cost of its current assets: S = 9 e- x/3 Find the...
-
Explain how you would use the alkene starting material inEq.6.2 to determine the absolute configuration of the dextrorotatory enantiomer of the following hydrocarbon: Outline the possible results of...
-
A 100-lbm block of a solid material whose specific heat is 0.5 Btu/lbmR is at 80F. It is heated with 10 lbm of saturated water vapor that has a constant pressure of 20 psia. Determine the final...
-
Show that the force acting on a control surface of any arbitrary control volume is equal to the force on a larger regularly shaped control volume enclosing the given body. In order to do this you...
-
Aneko Company reports the following ($ 000s): net sales of $ 14,800 for 2013 and $ 13,990 for 2012; end-of- year total assets of $ 19,100 for 2013 and $ 17,900 for 2012. Compute its total asset...
-
How do ethical leaders demonstrate authenticity and ethical authenticity, aligning personal values with organizational goals, and modeling ethical behavior to cultivate ethical awareness and...
-
Acme Parts runs a small factory and employs workers who are paid one of three hourly rates depending on their shift: first shift, $17 per hour; second shift, $18.50 per hour; third shift, $22 per...
-
Briefly discuss what a Fraud Risk Assessment is? Why should a company be interested in Fraud Risk Assessment? How can you ensure you have designed a good Fraud Risk Assessment.
-
DECLARE const char part1[] = "Dear " DECLARE const char part2[] = "Our records show that your account has a" " balance of $" DECLARE const char part3[] = " and a past due amount of $" DECLARE const...
-
Company A is a small firm involved in a wide range of food production. It relies on significant amounts of grain input, including wheat. The firm is considering launching one of two products labeled...
-
Distinguish between the terms unique class and connection point. [3 marks] (b) Explain exhaustively what happens when class GPS underneath is launched taking note of, specifically, any tasks that are...
-
Write a function that merges two sorted lists into a new sorted list. def merge_sorted_lists(l1, l2): merged_list = [] while l1 and l2: if l1[0] < l2[0]: merged_list.append(l1.pop(0)) ...
-
John Wilson is a 40 year old computer programmer, husband and father of four. He wants to use the capital retention approach to determine how much life insurance he should purchase. Because of his...
-
Q4. Given the following two implementations P1 and P2 of the same ISA, Class A CPI on P1 1 CPI on P2 Instr. Count 2 1000 B 2 2 2000 C 3 2 1000 D 4 4 3000 E 3 4 2000 P1 Clock Rate 4 GHz P2 Clock Rate...
-
Clark, PA, has been engaged to perform the audit of Kent Ltd.s financial statements for the current year. Clark is about to commence auditing Kents employee pension expense. Her preliminary enquiries...
-
Guenther and Firmin, both of whom are CPAs, form a partnership, with Guenther investing $100,000 and Firmin, $80,000. They agree to share net income as follows: 1. Salary allowances of $80,000 to...
-
The accounting staff of Wyoming Outfitters, Inc., has assembled the following information for the year ended December 31, 2011: Cash and cash equivalents, Jan. 1 . . . . . . . . . . . . . . . . . . ....
-
The following computation of the materials variances of Weitzen Foods is incomplete. The missing data are labeled (a) through (d). Materials price variance = 3,640 pounds [(a) standard price - $9.00...
-
Do you know about the chart of accounts in your organization as it pertains to information you receive?
-
If you receive reports in the course of your work, do you believe that they are prepared for outside (third party) use or for internal (management) use? What leads you to believe this?
-
If so, is it similar to one of the three formats illustrated in this chapter? If not, how is it different?
Study smarter with the SolutionInn App