Question: 2 * lg ( 2 ) + 2 * lg ( 5 ) - ( 1 / 2 ) lg ( 4 )

2*lg(2)+2*lg(5)-(1/2)lg(4)

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Programming Questions!

Q:

The participants targeted in this hypothetical study are children diagnosed with autism spectrum disorder (ASD), aged 3 to 6 years old. The focus on this age group is crucial as headbanging behavior...

Q:

Big Box retailing has a market capitalization of $200 million and 10 million shares outstanding. In order to finance its growth, the management of Big Box plans to raise further capital through a...

Q:

Differentiate y = 5x+ 6 lnx-6 cosx + e Question A9 Find Question A10 Find the two possible values of a if j(x-3) dx (4x-3) dx = 12a-1

Q:

Calculate the brand equity. Use ANOVA to check if the difference is statistically significant, and correlate this with the sales price Timestamp Sony: From this brand of television, I can expect...

Q:

In order to analyze the performance of smart phones, the characteristics of 292 smart phone models have been recorded. Assume that for the initial analysis we would like to work with a sample of 10...

Q:

All techniques: Decision among mutually exclusive investments Pound Industries is attempting to select the best of three mutually exclusive projects. The initial investment and after-tax cash inflows...

Q:

2. Look at all the variables in pairs. Which pairs are positively correlated? Negatively correlated? Are there any pairs that exhibit little or no correlation? Are some of these results...

Q:

3. Does the price of an appliance, specifically a washing machine, convey something about its quality? Which variables did you use in arriving at your answer? Does the price of an appliance convey...

Q:

dd Need help with question 2 OPMT 1110 Fall 201B Amount to be Paid - Amount Credited (1-d) Amo Credited Amount Paid x (1-d) Amount Lab Exercises: s20,00ust bhe paid on Sept 28 to pay off the 3...

Q:

4:44 Lab 2 o Post Lab Questions: Name ID# 1. Create a Perl Script that will translate the following DNA sequence (ATGCTGACCATTTTCTTTTCCTCCACTGAAGCA) into the 6 possible amino acid sequences (that...

Q:

a. Calculate the divisional margin for the year. b. Calculate the Du Pont ROI, and evaluate the performance of Paffer Resources in relation to the expected performance. c. Calculate the residual...

Q:

How do organizations use public relations tools? Give several examples that you have observed recently.

Q:

Find the limit . SCalcET 9 1 4 : 2 . 0 0 5 . ( x , y ) ( 3 , - 2 ) ( x 2 y 4 x y 2 5 )

Q:

A house has well-insulated walls. It contains a volume of 100 m3 of air at 300 K. (a) Calculate the energy required to increase the temperature of this diatomic ideal gas by 1.00C. (b) What If? If...

Q:

A hollow aluminum cylinder 20.0 cm deep has an internal capacity of 2.000 L at 20.0C. It is completely filled with turpentine and then slowly warmed to 80.0C. (a) How much turpentine overflows? (b)...

Q:

Here is a clever idea. Suppose you build a two-engine device such that the exhaust energy output from one heat engine is the input energy for a second heat engine. We say that the two engines are...

Q:

Help! One of our equations is missing! We describe constant acceleration motion with the variables and parameters vxi, vxf, ax, t, and xf - xi. Of the equations in Table 2.2, the first does not...

Q:

Helium gas is sold in steel tanks. If the helium is used to inflate a balloon, could the balloon lift the spherical tank the helium came in? Justify your answer. Steel will rupture if subjected to...

Q:

Design a minimum-mass symmetric three-bar truss (the area of member 1 and that of member 3 are the same) to support a load P, as was shown in Fig. 2.9. The following notation may be used: Pu = P cos...

Q:

1. Each member of the group should complete this step individually. Ask 25 different people to pick a digit from 0 to 9 at random. Record the responses.

Q:

2. Television is a refuge for people who are already unhappy. TV is not judgmental nor difficult, so people with few social skills or resources for other activities can engage in it. Furthermore,...

Q:

1. As a class, develop a plan for collecting the data. How will subjects be recruited? How will they be assigned to one of the two treatment groups (unaltered color, altered color)? What extraneous...