5. Assume you are given a DNA sequence (string) using four bases A, C, G, and T: dnaStr: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA Write a program that: 1. Defines a string of 30 characters. 2. Uses the function created in exercise 1 to initialized that string to a random DNA sequence. 3. Defines a function to black out the G's and C's, that is replace with a dot everything but all the T and A bases as follows: dnaStr: T...T..TA..A.AT.AT..A.TTTT.AAA.AA.AAA...T.A..A.AAA 5. Assume you are given a DNA sequence (string) using four bases A, C, G, and T: dnaStr: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA Write a program that: 1. Defines a string of 30 characters. 2. Uses the function created in exercise 1 to initialized that string to a random DNA sequence. 3. Defines a function to black out the G's and C's, that is replace with a dot everything but all the T and A bases as follows: dnaStr: T...T..TA..A.AT.AT..A.TTTT.AAA.AA.AAA...T.A..A.AAA