9:07 Done api.playposit.com C What will the flanking direct repeats be when this transposon is inserted in the following gene if the transposase creates a staggered cut of 6 base pairs in the upstream direction. Transposon: CCTCCTACTATCCGCGCAACGGAGG Gene: AAATCGTCGGGTCTACTACTACTCCCTGGACGCG TTTAGCAGCCCAGATGATGATGAGGGACCTGCGC CC What will the flanking direct repeats be when this transposon is inserted in the following gene if the transposase creates a staggered cut of 6 base pairs in the upstream direction. GGTCTA-TRANSPOSON-GGTCTA CCAGAT-TRANSPOSON-CCAGAT O CTACTA-TRANSPOSON-CTACTA GATGAT-TRANSPOSON-GATGAT O GGTCTA-TRANSPOSON-ATCTGG CCAGAT-TRANSPOSON-TAGACC CCTCC-TRANSPOSON-GGAGG GGAGG-TRANSPOSON-CCTCC 59:44 SUBMIT 1:15:26