A DNA sequence is formed by the nucleotides $$A$,$T$,$G$,$ and $$C$.$ A triplet of

nucleotides in such a sequence is called a codon.

$($a$)$ Write a program that takes a DNA string as input and prints the codons present in

the sequence. For example, for the sequence given below:

Input sequence: ATGGGTAACGTAAGCTAGTAACG

Output Codons: ATG, GGT$,$ AAC, GTA, AGC, TAG

$($b$)$ Write a program that calculates the frequency of each codon in a DNA sequence.

$[$Hint: The program creates a list of codons by slicing the DNA sequence into triplets

$($every $3$ characters$)$ using a list comprehension. The range is set to len$($dna$\_$sequence$)$

$-2$ to ensure that only complete triplets are extracted. Each codon$$s frequency is then

computed as its count divided by the total number of codons.$]$