A pressurized container produced from cast iron is closed and sealed at the top with a...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
A pressurized container produced from cast iron is closed and sealed at the top with a circular plate cover made of steel. A total of 16 low-carbon martensitic Q&T steel bolts are used to join the body and the cover, which are tightened to 90% of proof load. The pressure in the container fluctuates between 0 and 450 kPa during operation. Find the factor of safety against fatigue failure of a bolt using the Modified Goodman criterion. Data are as follows: Bolt type: M14 x 1.5 ISO 10.9, Eiron = 96 GPa Dimensions: A = 0.75 m, B = 0.9 m, C = 1 m, D = 30 mm, and E = 35 mm. Hint: Some useful tables (not available in the lecture notes) to refer to are given in Appendix at the end of this question sheet. B A E A pressurized container produced from cast iron is closed and sealed at the top with a circular plate cover made of steel. A total of 16 low-carbon martensitic Q&T steel bolts are used to join the body and the cover, which are tightened to 90% of proof load. The pressure in the container fluctuates between 0 and 450 kPa during operation. Find the factor of safety against fatigue failure of a bolt using the Modified Goodman criterion. Data are as follows: Bolt type: M14 x 1.5 ISO 10.9, Eiron = 96 GPa Dimensions: A = 0.75 m, B = 0.9 m, C = 1 m, D = 30 mm, and E = 35 mm. Hint: Some useful tables (not available in the lecture notes) to refer to are given in Appendix at the end of this question sheet. B A E
Expert Answer:
Answer rating: 100% (QA)
Solutions Step 1 In order to use the Modified Goodman criterion to determine a bolts factor of safety against fatigue failure we must first comprehend the criterion and the stress circumstances that t... View the full answer
Related Book For
Posted Date:
Students also viewed these mechanical engineering questions
-
XYZ Ltd operate two production lines. One was installed in April 2018 at a cost of 200,000. The other was installed in February 2020 at a cost of 340,000. They charge depreciation using the...
-
Let A, B be sets. Define: (a) the Cartesian product (A B) (b) the set of relations R between A and B (c) the identity relation A on the set A [3 marks] Suppose S, T are relations between A and B, and...
-
Josh Kuchin is studying for the next accounting mid-term examination. What should Josh know about? (a) Departing from the cost basis of accounting for inventories (b) The meaning of "market" in the...
-
Jean and Dan Sladek both work. Each earns a salary of $30,000, but only Jean is a member of a registered pension plan. Both she and her employer contribute 2% of her gross salary to a defined...
-
A customer profitability profile highlights those customers that should be dropped to improve profitability. Do you agree? Explain.
-
As the bulb ages, the resistance of the filament A. Increases. B. Decreases. C. Stays the same. You've probably observed that the most common time for an incandescent lightbulb to fail is the moment...
-
1. Calculate and express as a percentage the companies debt-to-assets ratios using amounts reported in the financial statements for fiscal 2016, which ends in early 2017. What do the differences in...
-
A weather balloon filled with ideal gas is released from earth and floats upward through the atmosphere. Its initial pressure and volume at the surface are Pi = Patm ( standard atmospheric pressure )...
-
At time t = 0, the baseball player releases a ball with the initial conditions shown in the figure. Determine the quantities r, r, r, , , and , all relative to the x-y coordinate system shown, at...
-
Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it...
-
List and explain the Criteria Used to Determine a Worker s Status?
-
Alpha Company manufactures leather bags. For the month of April, the total bags to account for are 28,000 and there are 8,000 bags in ending work-in-process (EWIP), 40% complete. There were 24,000...
-
Offer your own views on the strengths and weaknesses of Canadian multiculturalism.
-
A project assessment should provide the project manager with information about the gap between what is and what could be - sometimes including what those two points are. Identify a relevant scope and...
-
The price elasticity of demand for beef is -1.6. If the price of beef increases by 50%, what will happen to the quantity demanded?
-
1. n2 < 2" forn 4,5, 6,... You may assume: 2n +1 < 2" for n = 4, 5, 6,... 2. 13+ 23 + 33+...+n = "(n+1) for all n = 1,2,3,... 4 3. ++... + > Vn for n = 2, 3, 4,... 4. II, = ntl for n = 2, 3, 4, ......
-
Floyd Distributors, Inc., provides a variety of auto parts to small local garages. Floyd purchases parts from manufacturers according to the EOQ model and then ships the parts from a regional...
-
A tall standpipe with an open top (see figure) has diameter d = 2.2 m and wall thickness t = 20 mm. (a) What height h of water will produce a circumferential stress of 12 MPa in the wall of the...
-
An aluminum bar has length L = 5 ft and diameter d = 1.25 in. The stress-strain curve for the aluminum is shown in Fig. 1-13 of Section 1.3. The initial straight-line part of the curve has a slope...
-
A wood beam 8 in. wide and 12 in. deep (nominal dimensions) is reinforced on top and bottom by 0.25-in.-thick steel plates (see figure part a). (a) Find the allowable bending moment Mmax about the z...
-
The following data sets give the approximate lengths of Beethovens nine symphonies and Mahlers nine symphonies (in minutes). Beethoven: Mahler: 28 36 50 33 30 40 38 26 68 52 85 94 50 72 72 80 90 80
-
A recent study by the Kaiser Family Foundation looked at the role of media (for example, television, books, computers) in the lives of children. The report, which is on the Kaiser Family Foundation...
-
You manage a small ice cream shop in which your employees scoop the ice cream by hand. Each night, you total your sales and the total volume of ice cream sold. You find that on nights when an...
Study smarter with the SolutionInn App