Question: After DNA formed in protocells, q , had to evolve before DNA could serve as genetic information. amino acids the genetic code multicellularity nuclei

After DNA formed in protocells, q, had to evolve before DNA could serve as genetic information.
amino acids
the genetic code
multicellularity
nuclei
After DNA formed in protocells, q , had to evolve

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Finance Questions!

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

Part A Nucleotides have three parts: a phosphate group, a sugar, and a base. Label those parts in the nucleotide shown here. Drag each label to the appropriate target. View Available Hint(s) Reset...

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

O 32 20 3) Cos A Find the value of each trigonometric ratio as decimals rounded to the ten-thousandths place. 4) tan Z 8 Find the missing side. Round answers to the nearest tenth. show work i solve...

Q:

these 1) How did life originate on earth? A) Life started with meteors from space brought extra terrestrial life from which later evolved. B) Life existed on earth from the beginning and we do not...

Q:

You are charged with designing an occupational health and safety compliance training program for generic company--see Dyson article copied below: Choose a company in any of the following industries:...

Q:

For the article provided below please write down a PRESS RELEASE (three-hundred and fifity words MAX) that entails the following parts: the press release tries to distill the essence of the article's...

Q:

Problem 3 - DNA sequence operations (25 points) The DNA or deoxyribonucleic acid, is the hereditary material in almost all organisms (including humans) and it carries all the information about how a...

Q:

Question 2: answer any one of them thank you in c++ Find all the possible location where a pyrimidine dimmer can be formed in the given template strand. If the DNA is subject to UV radiations....

Q:

Problem. Powered number (Spot Write Java program which can input positive interesadach that I 1000000000 and 0-b210000) tested and print the Notice that the may be a very large, to sing pritive typ...

Q:

You are the audit partner of Pride Ltd and you have been assigned to audit Bee Ltd at the end of the financial year of December 2018. You are responsible for checking the receivables of the company...

Q:

What happens in oxidative phosphorylation (a) Energy is obtained from the electron released during substrate level oxidation to generate ATP (b) Phosphate group in ATP is oxidised (c) Phosphate group...

Q:

When preparing the operating activities section of the statement of cash flows using the indirect method, a decrease in accounts receivable is subtracted from net income. Group startsTrue or False

Q:

Can you elucidate the role of molecular chaperones and protein quality control systems in maintaining the integrity and homeostasis of the cytoplasm, particularly under conditions of cellular stress...