answer asap

Find Huffman Coding for the following micro RNA 2 sequences. These sequences are short strings made of 4 letters (A, C, G and U/T) representing specific nucleobases and heavily used and studied in DNA/RNA research. 1) CTGGGGGTTATCTTAGTGCCTCTCATGAATCGGG TGTTTTTCAAATTTCT 2) ACAGGAATTTTCATTGGTCATTATGCTGAAAATG TTTCTAT \# of bits in the coded string Also find compression ratio = bits in the original string bits in the orlginal string Make sure to draw the Huffman Tree and provide the code table. Please email a scan of your written work. You may work it out using PowerPoint or Word if you prefer - using these tools you can easily cut, copy or paste diagrams (you can't do this on a paper). Tree from today's class: AAAA BB AAAA CCC DD E Huffman Tree Leaf Nodes