Question: any python program that can conplete the assignmet is accepted Problem 2. Processing DNA in a File(Page 93) (The text for the problem is shown

 any python program that can conplete the assignmet is accepted Problem
2. Processing DNA in a File(Page 93) (The text for the problem
is shown below.) The ne input txt contains a number of DNA
any python program that can conplete the assignmet is accepted

Problem 2. Processing DNA in a File(Page 93) (The text for the problem is shown below.) The ne input txt contains a number of DNA sequences, one per line. Each sequence starts with the same 14 base pair fragment - a sequencing adapter that should have been removed. Write a program that will ) trim this adapter and write the cleaned sequences to a new file and (b) print the length of each sequence to the screen Download the file hate, Here is the data from the file as well ATTCOATINTAAGCTCATCOATCATCATCCATCOATCGATCGATCOATCCATO ATYCGATTATAAGCACIGATOGATCWTCCATOGATOGATOCTATOGTCGT ATTCGATTATAAGCATCCATCACGATOTATCGTACOTATOCATATCGATATCGATCGTAGTC AUTOGATTATAAOCACTATCGATCATCTACTACCATCGTAGCTSTA ATTCGATTATAAGCACTACTAGTCTCGATOCATGATCAGCTTAGCTGATGATOCYATGCA Problem 2. Processing DNA in a File (Page 93) (The text for the problem is shown below.) The file input.txt contains a number of DNA sequences, one per line. Each sequence starts with the same 14 base pair fragment - a sequencing adapter that should have been removed. Write a program that will (a) trim this adapter and write the cleaned sequences to a new file and (b) print the length of each sequence to the screen. ATTCGATTATAAGCTCGATCGATCGATCGATCGATCGATCGATCGA TCGATCGATC ATTCGATTATAAGCACTGATCGATCGATCGATCGATCGATGCTATC GTCGT ATTCGATTATAAGCATCGATCACGATCTATCGTACGTATGCATATC GATATCGATCGTAGTC ATTCGATTATAAGCACTATCGATGATCTAGCTACGATCGTAGCTGT A ATTCGATTATAAGCACTAGCTAGTCTCGATGCATGATCAGCTTAGC TGATGATGCTATGCA

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!