Question: b) Given the following Fasta file format (A sample fasta file is shown in Appendix 1) >gene id, gene name, organism, number of nucleotide base

b) Given the following Fasta file format (A sample fasta file is shown in Appendix 1) >gene id, gene name, organism, number of

b) Given the following Fasta file format (A sample fasta file is shown in Appendix 1) >gene id, gene name, organism, number of nucleotide base DNA sequences: [each line is 60 nucleotide characters in length] Write python code that: i Extract and print the gene id and gene name and organism for a Fasta file called PalGene fasta. (5 marks) ii. Determine and print all 6 reading frame sequences for a DNA sequence in a DNA fasta file with the structure of PalGene fasta (9 marks) iii. Determine and print the amino acid sequence of a DNA fasta, file (assume there is a condon conversion hash table called %codon_conversion) (6 marks) iv. For a given amino acid sequence: display the amino acid and nucleotide start/stop position of its Open Reading Frame (OFR) and the ORF amino acid sequence. (12 marks) Sample Fasta file (only partial DNA sequence is shown) >gi|171361, E. Coli, gamma-lyase(CYS3) gene, 5124bp GCAGCGCACGACAGCTGTGCTATCCCGGCGAGCCCGTGGCAGAGGACCTCGCTTGCGAAA. GCTACAGAGCCAACCCGGTGGACAAACTCGAAGTCATTGTGGACCGAATGAGGCTCAATAA b) Given the following Fasta file format (A sample fasta file is shown in Appendix 1) >gene id, gene name, organism, number of nucleotide base DNA sequences: [each line is 60 nucleotide characters in length] Write python code that: i Extract and print the gene id and gene name and organism for a Fasta file called PalGene fasta. (5 marks) ii. Determine and print all 6 reading frame sequences for a DNA sequence in a DNA fasta file with the structure of PalGene fasta (9 marks) iii. Determine and print the amino acid sequence of a DNA fasta, file (assume there is a condon conversion hash table called %codon_conversion) (6 marks) iv. For a given amino acid sequence: display the amino acid and nucleotide start/stop position of its Open Reading Frame (OFR) and the ORF amino acid sequence. (12 marks) Sample Fasta file (only partial DNA sequence is shown) >gi|171361, E. Coli, gamma-lyase(CYS3) gene, 5124bp GCAGCGCACGACAGCTGTGCTATCCCGGCGAGCCCGTGGCAGAGGACCTCGCTTGCGAAA. GCTACAGAGCCAACCCGGTGGACAAACTCGAAGTCATTGTGGACCGAATGAGGCTCAATAA

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Problem Description: You will be given a FASTA file which consists of a 1 line header describing the gene and then several lines which contain the DNA sequence (i.e., a combination of A, T, C, and G...

You have been hired by a genome lab to write a java program that will read in information from a text file and produce specific results to the screen and an output file. Concepts Arrays of objects...

the required functions are at the end for easy use. These are the functions required that I have coded. I am lost on how to contribute them into these new functions. Once the new functions are coded...

GENETICS AND FORCES OF EVOLUTION Introduction The goal of anthropological genetics is to understand the evolutionary relationships, demographic histories, and genetic bases of biological variation in...

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

Java dna1.txt 10 cure for cancer protein ATGCCACTATGGTAG captain sisko leadership protein ATgCCAACATGgATGCCcGATAtGGATTgA Ada Lovelace non protein CCATt-AATgATCa-CAGTt michael phelps protein...

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txt and ecoli.txt from below. Save these files in the same folder...

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txtand ecoli.txtfrom below. Save these files in the same folder...

Your task is to create a Python program that reads DNA sequences from an input file ( below is a file example illustrating how the data is organized ) and generates the consensus sequence....

O b j e c t i v e s Using File input/output Practice with loops and conditionals This project is based on the DNA Analysis homework in Michael Ernst's CSE 140 class at UW. I n t r o d u c t i o n You...

How does the availability of subcontracting affect the aggregate planning problem?

Describe the 5 steps involved in workforce planning. (100 words)

Explain the role of labor unions.

Madrid Co. has a direct labor standard of 4 hours per unit of output. Each employee has a standard wage rate of $12.00 per hour. During February, Madrid Co. paid $99,800 to employees for 9,160 hours...

What is meant by a progressive tax? A regressive tax? A proportional tax? Comment on the progressivity or regressivity of each of the following taxes, indicating in each case where you think the tax...

KEY QUESTION What is the incidence of an excise tax when demand is highly inelastic? Elastic? What effect does the elasticity of supply have on the incidence of an excise tax? What is the efficiency...

LAST WORD Explain how a global-positioning antitheft device installed by one car owner can produce a positive spillover to thousands of others in a city.