Question: Bioinformatics Consensus Given the following multiple sequence alignment: TTGGCTAGAATGGAATTGAC a) Write down the consensus profile [ 3 points] b) What is the score for the

Bioinformatics

Bioinformatics Consensus Given the following multiple sequence alignment: TTGGCTAGAATGGAATTGAC a) Write down

Consensus Given the following multiple sequence alignment: TTGGCTAGAATGGAATTGAC a) Write down the consensus profile [ 3 points] b) What is the score for the sequence AAAAA against the profile (match =+3, mismatch =1 ) [5 points] Do your calculations either in the text box here, or on paper and upload a photo of it

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Write an alternative definition that is tail-recursive (iterative) and makes use of accumulator variables. [10 marks] Explain why your alternative definition executes more efficiently. [3 marks] 1...

Consider the following context-free grammar of expressions E ::= n | (E, E) where n ranges over integers. (a) Present a right-most derivation of the expression ((21, 18), 17). [2 marks] (b) List the...

Computer Systems Modelling Consider a birth death model with birth rates n in states n = 0, 1, . . . and death rates n in states n = 1, 2, . . .. (a) State the detailed balance conditions for the...

BCO 313: Negotiation at Work Anne Dwyer: a.dwyer@euruni.edu Negotiation at Work \"Managers and executives negotiate constantly over issues as varied as hiring decisions and purchases, corporate...

(Simucase details at end) Directions: Write a treatment plan for Rob (Simucase) using the format depicted below: Your treatment plan should contain the following elements: Summarize the significant...

Please help me make an Executive Summary. Explain what you will examine in the case study. Write an overview of the field you are researching. Make a thesis statement and sum up the results of your...

Consider the following algorithm to solve the general Consensus with Byzantine faults, given a solution A for the binary Consensus. Every process p uses three private vari- ables, to store the...

QUESTION 4 Given the following alignment in context of motif finding problem, what is the consensus sequence ? cg gtac c t c c a tacgt c cat t agt acat g cct c catacgg ccatacgt ccttacgt ccatacgg...

You are given the three EPS estimates and the following estimates related to the market earnings multiple: a. Based on the three EPS and P/E estimates, compute the high, low, and consensus intrinsic...

As the newest member of the management team of your organization, you have been careful not to overstep your position. At the same time, as a smart Baruch student studying teamwork, you have noticed...

On January 1, the total market value of the Western Oil Co. was $100 million. During the year, the company plans to raise and invest $42 million in new projects. The firm's present market value...

Mead, CPA, had substantial doubt about Tech Co.'s ability to continue as a going concern when reporting on Tech's audited financial statements for the year ended June 30, Year 1. That doubt has been...

Question 5 The forecast of revenue growth is crucially important because many items in the income statement and the balance sheet are closely related to revenue. In addition to historical patterns...

1. What particularly intrigues you about this innovation? Why do you think it is needed and might or might not work in your community?

2. In what ways might the innovation be adapted to your particular community characteristics or needs?

1. What are the major sources of stress in your life? What are the major sources of stress at work? Write down three sources of stress for which you can take some sort of action to change.