Question: Can someone write a python program? Explain to me how the program work e appears 1 time in computer Program Set 4(10 points extra credit)

Can someone write a python program? Explain to me how the program work

e appears 1 time in computer Program Set 4(10 points extra credit) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, the program displays no gene is found. Here are the sample runs: RESTART: E:/HW3/HW3_4_genes.py Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT GGGCGT Enter a genome string: TGTGTGTATAT no gene is found Test with 4 more genome strings TGATGCTCTAAGGATGCGCCGTTGATT TGATGCTCTAGAGATGCGCCGTTGAATAT ious

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

test() 1 Overview Lab 6 will cover tuples and random number generation, both of which are used in this program. I suggest you view this document on the computer (as opposed to a black and white print...

Goals In this lab assignment, students will demonstrate the ability to: Create and use nested lists Create and use tuples Use list comprehension to create lists Install and use the matplotlib package...

A grammar is a set of rules for generating strings. For this lab, you will write a Python program that generates random strings using the rules of a grammar. For example, when the program was given...

The posted answer for this question on chegg is wrong. Need help in this 0. Introduction. A grammar is a set of rules for generating strings. For this project, you will write a Python program that...

2/11/2016 Take Test: Exam01 - 16SPFLCMAT101U2 Take Test: Exam01 Test Information Description This exam includes questions which ask you to fill in blanks with letters corresponding to statements and...

Program Organization Create a project5 folder somewhere on a flash drive, onedrive or on your computer. Name your main python file lettergrade-yourlastnome.py, and use your real last name. The...

ENGR 131 - Winter 2020-2021 Programming Project 2 The Harter-Heighway Dragon Curve The Harter-Heighway Dragon Curve is a particularly interesting curve drawn in the c-y plane using an iterative...

PLEASE INCLUDE PSEUDOCODE AND A FLOWCHART CS 1120 (Python) - Spring 2021 LA3 OOP distance calculator Lab Assignment 3 The Coordinate Distance Calculator Due Date (a two-week LA)...

need some help completing this lab 10 as soon as possible! the code in black is from a previous lab that i did that this one is a continuation of. the file with student names is one that i created...

A and B flip coins. A starts and continues flipping until a tail occurs, at which point B starts flipping and continues until there is a tail. Then A takes over, and so on. Let P1 be the probability...

Find the area under one arch of the trochoid of Exercise 38 in Section 10.1 for the case d

5.43 A foreign student club lists as its members 2 Canadians, 3 Japanese, 5 Italians, and 2 Germans. If a committee of 4 is selected at random, find the probability that (a) all nationalities are...

CT Corp Comprehensive Question Canadian Tire Corporation, Limited ( Canadian Tire ) is a family of companies that includes a retail segment and a financial services division, among others. The retail...

Give an example of a skip-and-jump survey question. Why should this type of question be avoided? (Objective 3)

How can a writer determine whether to use a formal, third-person style or an informal, firstperson style when writing a formal report? (Objective 1)

You are a new employee for Chapel Hill Gas Company.Your supervisor has asked you to use your creative talents in developing a simple message that could be used to remind customers to pay their bill...