Question: Consider an GGG codon in an mRNA that encodes a protein. If amutation changes anyone of the three bases to another base (onlyconsider cases where

Consider an GGG codon in an mRNA that encodes a protein. If amutation changes anyone of the three bases to another base (onlyconsider cases where 1 nucleotide is changed) how many differenttypes of amino acids could be found at that position in acollection of mutant genes?

Step by Step Solution

★★★★★

3.42 Rating (149 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

SOLUTION An GGG codon in an mRNA codes for amino acid GLYCINE There is no other sort of amino acid i... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Bertallo Classic produces tomato sauce at five different plants. The tomato sauce is then shipped to one of three warehouses, where it is stored until it is shipped to one of the companys four...

How many different amino acids could theoretically be encoded by nucleic acids containing four different nucleotides if (a) Each nucleotide coded for one amino acid; (b) Consecutive sequences of two...

The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU,UUC Asp: GAU, GAC These sequences are complementary to the sequences...

Consider the mutant genes described in Section 6.2, Exercise 27, where a wild type gene has a 1.0% chance of mutating each time a cell divides and a mutant gene has a 1.0% chance of reverting to wild...

Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte...

The technique of Western blotting can be used to detect proteins that are translated from a particular mRNA. This method is described in Chapter 20 and also in experimental question E5. Let's suppose...

Consider the following fragment of assembly language that is to be executed on a generic three way superscalar processor that can accommodate one memory access per clock. Rewrite the code to improve...

What is an operon? a. A site in the DNA where a regulatory protein binds b. A group of genes under the control of a single promoter c. An mRNA that encodes several genes d. All of the above are true...

Consider the experiment in Exercise 7-4. Suppose that the experiment was actually carried out on three levels of temperature and two positions. The data are the following: (a) Perform the analysis of...

Consider the experiment in Exercise 7-2. Suppose that the experiment was actually carried out on three types of drying times and two types of paint. The data are the following: (a) Perform the...

Boundaries of Pre-boarding. In the story of Daniel, we read about a quite extensive and lengthy pre-boarding program. When considering the possibility of including pre-boarding for new hires in the...

Consider a world of two countries, Highland (H) and Lowland (L). Each country has an average output of 9 and desires to smooth consumption. All income takes the form of capital income and is fully...

As shown in Fig. P6.94, a multi duct cross section consists of seven 2-cmdiameter smooth thin tubes packed tightly in a hexagonal bundle within a single 6-cm-diameter tube. Air, at about 20°C and...

Joie states that he hari completely coundertalanced the conditom in his reperiment, What does thin mean? tel lias an equal remeter of participunts in all soultions All posubte orfers at presentation...

(a) How long did it take for a message sent from Earth to reach the first astronauts on the Moon? (b) How long will it take for a message from Earth to reach the first astronauts who arrive on Mars;...

A study was undertaken at the Virginia Polytechnic Institute and State University to determine if fire can be used as a viable management tool to increase the amount of forage available to deer...

The assembly shown consists of two pieces of sheet aluminum of uniform thickness and total mass 1.6 kg welded to a light axle supported by bearings A and B. Knowing that the assembly rotates with an...

A student performs a combustion experiment by burning a mixture of fuel and oxygen in a constant-volume metal can surround by a water bath. During the experiment the temperature of the water is...

Using a method of your choice, verify each of the equivalences inFigure. (a AB) = (BA a) commutativity of A (a v B) = (B V a) commutativity of v ((a ^ 3) A7) = (a^ (BA)) associativity of A ((a V B) v...

For the function g whose graph is given, state the following. (If the limit is infinite, enter '' or '-', as appropriate. If the limit does not otherwise exist, enter DNE.) The x y-coordinate plane...

ChatGPT ChatGPT To break down the calculation of probabilities for each possible triplet codon consisting entirely of As or Cs, we'll consider each triplet codon individually and calculate the...

Part A Nucleotides have three parts: a phosphate group, a sugar, and a base. Label those parts in the nucleotide shown here. Drag each label to the appropriate target. View Available Hint(s) Reset...

This assignment is an exercise to increase your familiarity with python and three different kinds of mutations: silent, where the codon changes to another codon for the same amino acid nonsense,...

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Answers only needed for b) through e) Recall that a DNA is composed of 4 different nucleotides, G, C, A, and T (or U), grouped as 2 pairs (G with C, and A with T). The complementary pairing...

Recall that a DNA is composed of 4 different nucleotides, G, C, A, and T (or U), grouped as 2 pairs (G with C, and A with T). The complementary pairing facilitates transcription of DNA into RNA....