Question: Consider the following 10 sequences with the 10 highlighted substrings, Construct a consensus sequence of the 10 substrings as the motif. 2. Consider the above

Consider the following 10 sequences with the 10 highlighted substrings, Construct a consensus sequence of the 10 substrings as the motif.

Consider the following 10 sequences with the 10 highlighted substrings, Construct a

2. Consider the above 10 DNA input strings, with each string of length 82. If we build a 10-partitte graph, with motif length 15 and d = 8, how many vertices are there in the graph? How many leaf nodes in the bounded search tree (without any heuristic pruning)? What is the size of the largest clique of the graph?

Sample with (15,4)-motif AAAAAAAAGGGGGGG atgaccgggatactgat GAAGAAAGGEta ggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAALAAAACGGCGG tgagtatccctgggatgact Attocact tgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgcAAAAAAAGGGattccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggetogttacgtagggaagccctaacggacttaatAtAAEAAAGGadottatag gtcaatcatgttcttgtgaatggatt AACHALAAGGGCT gaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgt AACAAGGGGGccaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttAAAAAAGGGacccctggggcaatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggotaaaagcccaacttgacaaatggaagatagaatccttgcat CDAAA.Caccccaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagetfgcttccggggatctaatagcaggaagctt CLAAAAAGGAGccca AGAAGAAAGGGGGGG ....111.1..111 CAALAAAAGGGGGG Sample with (15,4)-motif AAAAAAAAGGGGGGG atgaccgggatactgat GAAGAAAGGEta ggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAALAAAACGGCGG tgagtatccctgggatgact Attocact tgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgcAAAAAAAGGGattccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggetogttacgtagggaagccctaacggacttaatAtAAEAAAGGadottatag gtcaatcatgttcttgtgaatggatt AACHALAAGGGCT gaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgt AACAAGGGGGccaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttAAAAAAGGGacccctggggcaatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggotaaaagcccaacttgacaaatggaagatagaatccttgcat CDAAA.Caccccaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagetfgcttccggggatctaatagcaggaagctt CLAAAAAGGAGccca AGAAGAAAGGGGGGG ....111.1..111 CAALAAAAGGGGGG

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

BE562: Problem Set 3 Fall 2016 Due 10/21/2016 8PM 1. Hidden Markov Models and Protein Structure (20 pts) One biological application of hidden Markov models is to determine the secondary structure...

Sometimes to process DNA data files a consensus sequence is created when there are many similar DNA sequences in a file. A consensus sequence is obtained by choosing the most highly-occurring...

Tasks The goal of the project is to complete the code for the NgramAnalyser, MarkovModel, ModelMatcher and MatcherController classes, as detailed below, and to add test code to a new JUnit test...

4. Consider the following variant of string alignment: given two strings x, y, and a positive integer L, find all contiguous substrings of length at least L that are aligned (using no-ops...

Miller-Rabin test to check whether a number N is composite. This will involve computing a N1 mod N for some value of a. [10 marks] Carry out the steps for N = 65 and a = 1, 2, 8 and 12. on what each...

ttth Suppose that the sequence of bags {Bn | n N} is recursively enumerated by the computable function e(n, x) = fn(x), [7 marks] Hence prove that the set of all recursive bags cannot be recursively...

Let r and s be solutions to the quadratic equation x 2 b x + c = 0. For n N, define d0 = 0 d1 = r s dn = b dn1 c dn2 (n 2) Prove that dn = r n s n for all n N. [4 marks] (b) Recall that a commutative...

Portray in words what transforms you would have to make to your execution to some degree (a) to accomplish this and remark on the benefits and detriments of this thought.You are approached to compose...

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

(a) In SystemVerilog, what is the difference between: (i) The ternary operator ? and if...then...else statements? [2 marks] (ii) always_ff and always_comb? [2 marks] (iii) Blocking, non-blocking and...

Let CR" be a bounded, open subset with smooth boundary an. Consider the boundary-value problem (BVP) -Au = f u=0 where fEL(2). Further define the functional in on an 1 [w] := ( 1 || VW|| -- wf )...

lonic compounds formed between cations from a metal, and anions from a non-metal, are more likely to be soluble than covalent compounds formed between two non-metals. Which of the following compounds...

Home mortgage borrowers sometimes pay points to thelir mortgage lender in order to reduce their interest rate. If you agree to pay one point on a $ 1 5 0 . o 0 0 loan, how euch wil you pay up front...

saved Weatherly Lumber Company processes wood pulp for manufacturing various paper products. The company employs a process costing system for its manufacturing operations. All direct materials are...

LAST WORD What groups benefit and what groups lose from the U.S. sugar subsidy program?

KEY QUESTION Using the concepts in Chapter 19s discussion of consumer behavior, explain how health care insurance results in an overallocation of resources to the health care industry. Use a demand...

KEY QUESTION Briefly discuss the major causes of income inequality. With respect to income inequality, is there any difference between inheriting property and inheriting a high IQ? Explain.