Question: Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ATTTTAAATTAGCATTTAAT3 Strand 2: 5ATGCCGATATTTTTAGCGCA3 Strand 3: 5AGCGGGGCGGCAGCGCGGAT3

Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments:

 Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ

 Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ

 Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ 

Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ

Step by Step Solution

★★★★★

3.37 Rating (150 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

Normally the DNA strands which have more Guanine and Cytosine are having more melting point G C Con... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

Ken is 6 3 years old and unmarried. He retired at age 5 5 when he sold his business, Understock.com. Though Ken is retired, he is still very active. Ken reported the following financial information...

Q:

Explain how you could differentiate between the compounds in each of the following pairs by using simple physical or chemical tests that give readily observable results, such as obvious solubility...

Q:

What is a Gantt chart Describe and illustrate how a company can effectively incorporate it into its management of its production operation?

Q:

Describe and illustrate how an EBDAT (survival) breakeven chart is constructed.

Q:

Describe the total-cost-of-ownership orientation that purchasing managers use and illustrate how you could apply it to your next automobile purchase decision.

Q:

You hold 20,000 shares in ABC plc which are currently priced at 500p. ABC has developed a revolutionary flying machine. If trials prove successful the share price will rise significantly. If the...

Q:

Explain how you could distinguish between the following two compounds using NMR coupling constants. (These compounds are derived from glucose, by a reaction we shall study in Chapters 16 and 22.) A B...

Q:

When treated with a strong base, 2-bromo-2,3-dimethylbutane will undergo an elimination reaction to produce two products. The choice of base (ethoxide vs. tert-butoxide) will determine which of the...

Q:

=+1 You hold 20,000 shares in ABC plc which are currently priced at 500p. ABC has developed a revolutionary flying machine. If trials prove successful the share price will rise significantly. If the...

Q:

1. 2-Pentanone and valeraldehyde base close boiling points, 102 and 103 0 respectively. Suggest a way that these two compounds could be distinguished and identified. (A boiling point difference of 1...

Q:

There are numerous ways to garner students' attention and have them engage with new content and information. For example, students may enjoy visual pictures or charts/graphs that support other...

Q:

Explain how people professionals create value for people, organisations and wider stakeholders. Divide this answer into three sections: Explain how HR creates value/ makes a difference for: 1. people...

Q:

Klara is 25 years old and is planning for her retirement. She wants to consider both options of retiring at age 60 or at age 65, and has no savings into her RRSP yet. She figures she would like to...

Q:

uestion 8 of 8 Use the Power Rule to compute the derivative. ( Use symbolic notation and fractions where needed. ) d d t t - 1 5 | t | = 1 =

Q:

Snowden Industries produces two electronic decoders, P and Q. Decoder P is more sophisticated and requires more programming and testing than does Decoder Q. Because of these product differences, the...

Q:

The statement of financial position for Paragon Corporation at November 30, 2009, the end of its current fiscal year, follows. The market price of the companys common stock was $4 per share on...

Q:

Organic Health Care Products Inc. expects to maintain the same inventories at the end of 20Y8 as at the beginning of the year. The total of all production costs for the year is therefore assumed to...

Q:

On November 21, 2013, a fire at Hodge Companys warehouse caused severe damage to its entire inventory of Product Tex. Hodge estimates that all usable damaged goods can be sold for $12,000. The...

Q:

Refer to Practice 168. The company had no taxable income in past years. Analysis of prospects for the future indicates that it is more likely than not that total taxable income in the foreseeable...

Q:

Write the letter to persuade management based on your findings and recommendations made to the H R manager in the email, increase THREE benefits to the employees. ( The three benefits are going to be...

Q:

1:041 M2 Assignments 19SPCSCI580350 DATA WAREHOUSING The Quick Links give quick access to some of the climate data sources. You can also explore some of the other links in the left-hand side panel if...

Q:

Answer the questions below. Note that to address some problems that may result in changes in investment in equilibrium, you need to first analyze the effect on the loanable funds market, then...

Q:

In approximately 225-250 words, Explain in your own words what did you learn is the focus of managerial accounting? Choose one module (Module 2 thru 6) and reflect on how the core concepts described...

Q:

In approximately 225-250 words, Explain in your own words what did you learn is the focus of managerial accounting? Choose one module (Module 2 thru 6) and reflect on how the core concepts described...

Q:

PR 2-10 Entries into accounts and Trial Balance OBJ. 1. Describe the characteristics of an account and a chart of accounts.2- Describe and illustrate journalisting transactions using the double-entry...

Q:

1. Identify the foreign keys in this Schemal. Explain how the entity and referential integrity rules apply to these relations. Hotel (hotelNo, hotelName, city) Room (roomNo, hotelNo, type, price)...