Question: Describe the effect a mutation will have on the trp operon's expression, if the mutation prevents the binding of the ribosome to the mRNA 5'

Describe the effect a mutation will have on the trp operon's expression, if the mutation prevents the binding of the ribosome to the mRNA 5' UTR upstream of the leader peptide sequence

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Accounting Questions!

Mutations may have an effect on the expression of the lac operon and the trp operon. Would the following mutations have a cis- or trans-effect on the expression of the protein-encoding genes in the...

You are studying a human mRNA that you believe is controlled at the level of translation. You think that the 5-UTR plays a role by binding to a protein that prevents the initiation of translation. To...

5. Explain how the Bohr effect plays a role in oxygen transport in vivo. 6. Identify the mutation(s) in hemoglobin that result in the genetic disorder sickle cell disease. Then, describe the effect...

A gene mutation changes an AT base pair to a GC pair. This causes a gene to encode a truncated protein that is nonfunctional. An organism that carries this mutation cannot survive at high...

The fruit fly Drosophila melanogaster normally has a gray color. However, because of mutation a good portion of them are black. A biologist eager to learn about the effect of mutation wants to...

Consider the following sequence and explain what effect the mutation has on the protein that is translated. (wild type) (mutant) UCUAUGUUUCACAGAGGGAAACCCUAACCC UCUAUGUUUCACUGAGGGAAACCCUAACCC complete...

You are a geneticist specialising in paediatric diseases and disorders. One day Martin and Lorna bring their daughter Ruby to see you. Ruby is 4 years old and her parents are concerned that she...

1) The map below shows the relative positions of four autosomal markers on a normal Drosophila autosome. d 25.7mu units. Phenotype abcd a+c+ abc + a+cd Total C 2.2mu # of flies 91 89 9 11 200 a...

MAT 343 LAB 3 Example We can generate the three matrices listed in (1) using the following MATLAB commands >>E1eye (4) >> E1( [2,3], :) E1( [3,2], :) % swap rows 2 and 3 E1 = % generate the 4x4...

Evaluate the profitability of the integrated system's operations. The integrated system operations were ____. a. not profitable b. profitable Net income of _____. a. $10,400,000 is 32% b. $856,800 is...

Equation 9.36 describes the most general linearly polarized wave on a string. Linear (or "plane") polarization (so called because the displacement is parallel to a fixed vector n) results from the...

Refer to Data Set 16 in Appendix B and use the magnitudes and depths from the earthquakes. Find the best predicted depth of an earthquake with a magnitude of 1.50. In each case, find the regression...

What is the role of society for a group of young adults who are delayed in their career aspirations as a result of an economic recession? Should the nation do something to ensure that these Americans...

Q What is the function of anti-pumping in the circuit breaker?